The name of the primary motif.
The logo of the primary motif.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The number of secondary motifs found that had significant spacings in the tested region.
The list of secondary motifs found that had significant spacings in the tested region.
The name of the sequence database.
The last modified date of the sequence database.
The number of sequences in the sequence database.
The number of sequences in the sequence database which were excluded because they were shorter than twice the margin plus the primary motif length.
The number of sequences in the sequence database which were excluded because no match to the primary motif could be found at a distance to the edges larger than the margin.
The number of sequences in the sequence database which were excluded because they were largly identical to other sequences when aligned on the primary motif site.
The number of sequences which were scanned with the secondary motifs.
The name of the motif database derived from the file name.
The date that the motif database was last modified.
The number of motifs loaded from the motif database. Some motifs may have been excluded.
The number of motifs with significant E-values whose significant spacings were not considered too similar to those of another motif.
The number of motifs that while having significant spacings were less signficant than another motif that matched most of the same sites.
The primary motif is used as the reference point for all spacing calculation.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The secondary motif occurs at the spacings relative to the primary shown in the histogram below.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The E-value is the lowest p-value of any spacing of the secondary motif times the number of secondary motifs. It estimates the expected number of random secondary motifs that would have the observed minimum p-value or less.
The histogram below shows the frequency of spacings from the primary motif to the secondary motif. Red bars indicate that a spacing has occured a statistically significant number of times.
The details of the significant spacings are shown in the four quadrants as they relate to the quadrants of the graph.
The total number of sequences that have a match for both the primary motif and this secondary motif.
The motif database which this secondary motif came from.
The list of secondary motifs which have been identified as possibly similar to this motif because their most significant spacings overlaped with the most significant spacing of this motif. Check the boxes to show the possibly similar secondary motifs.
This shows the first secondary motif aligned with the current secondary motif by the most significant spacing.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
For further information on how to interpret these results or to get a copy of the MEME software please access http://meme.nbcr.net.
If you use SpaMo in your research please cite the following paper:
Tom Whitington, Martin C. Frith, James Johnson and Timothy L. Bailey,
"Inferring transcription factor complexes from ChIP-seq data",
Nucleic Acids Research, 39(15):e98, 2011.
[full text]
Primary Motif |
Next Top |
| Name | Preview | Significant Secondaries | List |
|---|---|---|---|
| MA0007.2 (AR) |
AAGAACAGAATGTTC
|
61 | RAGKTCA (DREME), CTGAGYCA (DREME), UP00232 1 (Dobox4 3956.2), UP00079 2 (Esrra secondary), MA0139.1 (CTCF), GCTGGRGA (DREME), TACADA (DREME), MA0017.1 (NR2F1), MA0258.2 (ESR2), UP00040 2 (Irf5 secondary), MA0505.1 (Nr5a2), MA0526.1 (USF2), MA0018.2 (CREB1), MA0059.1 (MYC::MAX), AGGHCA (DREME), UP00077 2 (Srf secondary), MA0144.2 (STAT3), MA0510.1 (RFX5), UP00066 1 (Hnf4a primary), UP00076 1 (Rfxdc2 primary) |
Sequence Database |
Previous Next Top |
| Name | Last Modified | Loaded | Too Short | No Primary | Too Similar | Used |
|---|---|---|---|---|---|---|
| Static Sex-independent | Wed Jun 7 10:47:08 2017 | 67058 | 0 | 50712 | 2 | 16344 |
Secondary Databases |
Previous Next Top |
| Name | Last Modified | Number of Motifs | Motifs Significant | Motifs Redundant |
|---|---|---|---|---|
| meme.xml | Wed Jun 7 10:49:30 2017 | 3 | 1 | 0 |
| dreme.xml | Wed Jun 7 15:52:22 2017 | 63 | 15 | 2 |
| JASPAR CORE 2014 vertebrates | Wed Jun 7 10:46:42 2017 | 204 | 24 | 9 |
| uniprobe mouse | Wed Jun 7 10:46:42 2017 | 386 | 21 | 6 |
Spacings of "RAGKTCA (DREME)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: RAGKTCA (DREME) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
AAGGTCA
|
8e-20 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4948Motif Databasedreme.xml |
||||||||||||||||||
| Similar Secondary: UP00053 1 (Rxra primary) | |||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7066Alignment by most significant spacings
|
||||||||||||||||||||||
| Similar Secondary: MA0071.1 (RORA 1) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4601Alignment by most significant spacings
|
||||||||||||||
| Similar Secondary: UP00009 1 (Nr2f2 primary) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7143Alignment by most significant spacings
|
||||||||||||||
| Similar Secondary: MA0141.2 (Esrrb) | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7155Alignment by most significant spacings
|
||||||||||||||||||
Spacings of "CTGAGYCA (DREME)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: CTGAGYCA (DREME) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
CTGAGTCA
|
1.8e-16 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1216Motif Databasedreme.xml |
||||||||||||||||||
| Similar Secondary: MA0478.1 (FOSL2) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2507Alignment by most significant spacings
|
||||||||||||||
Spacings of "UP00232 1 (Dobox4 3956.2)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: UP00232 1 (Dobox4 3956.2) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
TAAATAGATACCCCATA
|
2.1e-12 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2685Motif Databaseuniprobe mouse |
||||||||||
Spacings of "UP00079 2 (Esrra secondary)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: UP00079 2 (Esrra secondary) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
GGCGAGGGGTCAAGGGC
|
4.1e-12 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6358Motif Databaseuniprobe mouse |
||||||||||
| Similar Secondary: UP00009 2 (Nr2f2 secondary) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4478Alignment by most significant spacings
|
||||||||||||||
Spacings of "MA0139.1 (CTCF)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: MA0139.1 (CTCF) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
TGGCCACCAGGGGGCGCTA
|
1.1e-10 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3547Motif DatabaseJASPAR CORE 2014 vertebrates |
||||||||||
| Similar Secondary: AGRDGGCG (DREME) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1163Alignment by most significant spacings
|
||||||||||||||
Spacings of "GCTGGRGA (DREME)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: GCTGGRGA (DREME) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
GCTGGAGA
|
1.9e-10 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1149Motif Databasedreme.xml |
||||||||||
Spacings of "TACADA (DREME)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: TACADA (DREME) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
TACAAA
|
3.1e-09 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5532Motif Databasedreme.xml |
||||||||||
Spacings of "MA0017.1 (NR2F1)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: MA0017.1 (NR2F1) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
TGACCTTTGAACCT
|
3.5e-08 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4428Motif DatabaseJASPAR CORE 2014 vertebrates |
||||||||||||||||||
Spacings of "MA0258.2 (ESR2)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: MA0258.2 (ESR2) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
AGGTCACCCTGACCT
|
1.1e-07 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6323Motif DatabaseJASPAR CORE 2014 vertebrates |
||||||||||
| Similar Secondary: CAGGMTG (DREME) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3560Alignment by most significant spacings
|
||||||||||||||
| Similar Secondary: MA0112.2 (ESR1) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6164Alignment by most significant spacings
|
||||||||||||||
| Similar Secondary: UP00036 2 (Myf6 secondary) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7650Alignment by most significant spacings
|
||||||||||||||
Spacings of "UP00040 2 (Irf5 secondary)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: UP00040 2 (Irf5 secondary) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
TTGATCGAGAATTCC
|
1.9e-07 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5623Motif Databaseuniprobe mouse |
||||||||||
Spacings of "MA0505.1 (Nr5a2)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: MA0505.1 (Nr5a2) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
AAGTTCAAGGTCAGC
|
7.3e-07 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5243Motif DatabaseJASPAR CORE 2014 vertebrates |
||||||||||
Spacings of "MA0526.1 (USF2)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: MA0526.1 (USF2) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
GTCATGTGACC
|
8.3e-07 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3582Motif DatabaseJASPAR CORE 2014 vertebrates |
||||||||||
| Similar Secondary: MA0104.3 (Mycn) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2596Alignment by most significant spacings
|
||||||||||||||
Spacings of "MA0018.2 (CREB1)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: MA0018.2 (CREB1) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
TGACGTCA
|
8.3e-07 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5948Motif DatabaseJASPAR CORE 2014 vertebrates |
||||||||||
Spacings of "MA0059.1 (MYC::MAX)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: MA0059.1 (MYC::MAX) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
GACCACGTGGT
|
2.2e-06 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2397Motif DatabaseJASPAR CORE 2014 vertebrates |
||||||||||
| Similar Secondary: MA0058.2 (MAX) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3404Alignment by most significant spacings
|
||||||||||||||
| Similar Secondary: MA0147.2 (Myc) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2776Alignment by most significant spacings
|
||||||||||||||
Spacings of "AGGHCA (DREME)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: AGGHCA (DREME) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
AGGCCA
|
7.9e-06 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif10498Motif Databasedreme.xml |
||||||||||||||
| Similar Secondary: MA0160.1 (NR4A2) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif11145Alignment by most significant spacings
|
||||||||||||||
Spacings of "UP00077 2 (Srf secondary)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: UP00077 2 (Srf secondary) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
GTTAAAAAAAAAAATTT
|
1.9e-05 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8043Motif Databaseuniprobe mouse |
||||||||||||||||||
Spacings of "MA0144.2 (STAT3)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: MA0144.2 (STAT3) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
CTTCTGGGAAA
|
0.00036 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5757Motif DatabaseJASPAR CORE 2014 vertebrates |
||||||||||
| Similar Secondary: MA0137.3 (STAT1) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3445Alignment by most significant spacings
|
||||||||||||||
Spacings of "MA0510.1 (RFX5)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: MA0510.1 (RFX5) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
CTCCCTGGCAACAGC
|
0.0011 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5366Motif DatabaseJASPAR CORE 2014 vertebrates |
||||||||||
Spacings of "UP00066 1 (Hnf4a primary)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: UP00066 1 (Hnf4a primary) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
CTTCAGGGGTCAATTGA
|
0.0011 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6064Motif Databaseuniprobe mouse |
||||||||||
Spacings of "UP00076 1 (Rfxdc2 primary)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: UP00076 1 (Rfxdc2 primary) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
CCGCATAGCAACGGA
|
0.0011 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2792Motif Databaseuniprobe mouse |
||||||||||
Spacings of "MA0512.1 (Rxra)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: MA0512.1 (Rxra) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
CAAAGGTCAGA
|
0.0015 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8958Motif DatabaseJASPAR CORE 2014 vertebrates |
||||||||||||||||||
Spacings of "AGGCDGAG (DREME)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: AGGCDGAG (DREME) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
AGGCTGAG
|
0.0017 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1747Motif Databasedreme.xml |
||||||||||
Spacings of "UP00101 2 (Sox12 secondary)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: UP00101 2 (Sox12 secondary) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
AAATAGACAAAGGAAT
|
0.0019 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif11325Motif Databaseuniprobe mouse |
||||||||||
Spacings of "3 (MEME)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: 3 (MEME) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
TTTGTTTTTTTTTTTGTTTGTTTTTAAG
|
0.019 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1049Motif Databasememe.xml |
||||||||||||||||||
Spacings of "CCBGCCTC (DREME)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: CCBGCCTC (DREME) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
CCTGCCTC
|
0.058 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1320Motif Databasedreme.xml |
||||||||||
Spacings of "ACACRB (DREME)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: ACACRB (DREME) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
ACACAG
|
0.097 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif10271Motif Databasedreme.xml |
||||||||||
Spacings of "CHGGRA (DREME)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: CHGGRA (DREME) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
CTGGGA
|
0.13 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif13382Motif Databasedreme.xml |
||||||||||
Spacings of "MA0504.1 (NR2C2)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: MA0504.1 (NR2C2) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
AGGGGTCAGAGGTCA
|
0.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4791Motif DatabaseJASPAR CORE 2014 vertebrates |
||||||||||
Spacings of "UP00056 1 (Rfx4 primary)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: UP00056 1 (Rfx4 primary) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
TACCATAGCAACGGT
|
0.26 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2171Motif Databaseuniprobe mouse |
||||||||||
Spacings of "UP00011 1 (Irf6 primary)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: UP00011 1 (Irf6 primary) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
CTGATCGAAACCAAAGT
|
0.37 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2762Motif Databaseuniprobe mouse |
||||||||||
Spacings of "RGAAAB (DREME)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: RGAAAB (DREME) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
AGAAAG
|
0.42 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif12388Motif Databasedreme.xml |
||||||||||
Spacings of "UP00011 2 (Irf6 secondary)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: UP00011 2 (Irf6 secondary) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
ACCACTCTCGGTCAC
|
0.45 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6479Motif Databaseuniprobe mouse |
||||||||||
Spacings of "MA0095.2 (YY1)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: MA0095.2 (YY1) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
CAAGATGGCGGC
|
0.54 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3068Motif DatabaseJASPAR CORE 2014 vertebrates |
||||||||||
Spacings of "MA0027.1 (En1)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: MA0027.1 (En1) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
AAGTAGTGCCC
|
0.57 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7926Motif DatabaseJASPAR CORE 2014 vertebrates |
||||||||||
Spacings of "UP00102 2 (Zic1 secondary)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: UP00102 2 (Zic1 secondary) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
CCACACAGCAGGAGA
|
0.65 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7917Motif Databaseuniprobe mouse |
||||||||||
| Similar Secondary: UP00057 2 (Zic2 secondary) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7717Alignment by most significant spacings
|
||||||||||||||
| Similar Secondary: UP00006 2 (Zic3 secondary) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7795Alignment by most significant spacings
|
||||||||||||||
Spacings of "CYGCCDCC (DREME)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: CYGCCDCC (DREME) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
CTGCCGCC
|
0.85 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2157Motif Databasedreme.xml |
||||||||||
Spacings of "GATGAYGA (DREME)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: GATGAYGA (DREME) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
GATGATGA
|
0.98 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif214Motif Databasedreme.xml |
||||||||||
Spacings of "UP00161 1 (Hmbox1 2674.1)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: UP00161 1 (Hmbox1 2674.1) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
GAAAACTAGTTAACATC
|
1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3856Motif Databaseuniprobe mouse |
||||||||||
Spacings of "MA0518.1 (Stat4)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: MA0518.1 (Stat4) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
TTTCCAGGAAATGG
|
1.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4477Motif DatabaseJASPAR CORE 2014 vertebrates |
||||||||||
Spacings of "MA0502.1 (NFYB)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: MA0502.1 (NFYB) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
AAATGGACCAATCAG
|
1.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1954Motif DatabaseJASPAR CORE 2014 vertebrates |
||||||||||
Spacings of "MA0093.2 (USF1)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: MA0093.2 (USF1) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
GCCACGTGACC
|
1.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4313Motif DatabaseJASPAR CORE 2014 vertebrates |
||||||||||
Spacings of "UP00034 1 (Sox7 primary)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: UP00034 1 (Sox7 primary) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
AATAAAGAACAATAGAATTTCA
|
2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5725Motif Databaseuniprobe mouse |
||||||||||
Spacings of "MA0517.1 (STAT2::STAT1)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: MA0517.1 (STAT2::STAT1) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
TCAGTTTCATTTTCC
|
2.3 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3899Motif DatabaseJASPAR CORE 2014 vertebrates |
||||||||||
Spacings of "UP00176 1 (Crx 3485.1)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: UP00176 1 (Crx 3485.1) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
CGTTGGGGATTAGCCT
|
2.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1523Motif Databaseuniprobe mouse |
||||||||||
Spacings of "MA0483.1 (Gfi1b)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: MA0483.1 (Gfi1b) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
AAATCACAGCA
|
2.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4724Motif DatabaseJASPAR CORE 2014 vertebrates |
||||||||||
Spacings of "ARAGGGCA (DREME)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: ARAGGGCA (DREME) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
AGAGGGCA
|
3.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1153Motif Databasedreme.xml |
||||||||||
Spacings of "MA0509.1 (Rfx1)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: MA0509.1 (Rfx1) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
GTTGCCATGGCAAC
|
3.3 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2860Motif DatabaseJASPAR CORE 2014 vertebrates |
||||||||||
Spacings of "UP00087 2 (Tcfap2c secondary)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: UP00087 2 (Tcfap2c secondary) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
CCGCCCAAGGGCAG
|
4.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8237Motif Databaseuniprobe mouse |
||||||||||
Spacings of "UP00024 2 (Glis2 secondary)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: UP00024 2 (Glis2 secondary) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
AATATTAATAAAGA
|
4.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6192Motif Databaseuniprobe mouse |
||||||||||
Spacings of "MA0050.2 (IRF1)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: MA0050.2 (IRF1) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
TTTTACTTTCACTTTCACTTT
|
4.9 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3724Motif DatabaseJASPAR CORE 2014 vertebrates |
||||||||||||||
Spacings of "MA0500.1 (Myog)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: MA0500.1 (Myog) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
GACAGCTGCAG
|
5.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4314Motif DatabaseJASPAR CORE 2014 vertebrates |
||||||||||
Spacings of "MA0597.1 (THAP1)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: MA0597.1 (THAP1) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
CTGCCCGCA
|
5.6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif11875Motif DatabaseJASPAR CORE 2014 vertebrates |
||||||||||
Spacings of "UP00082 2 (Zfp187 secondary)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: UP00082 2 (Zfp187 secondary) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
GAGCCCTTGTCCCTTG
|
5.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7602Motif Databaseuniprobe mouse |
||||||||||
Spacings of "UP00029 1 (Tbp primary)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: UP00029 1 (Tbp primary) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
TCTTTATATATAAATA
|
6.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4307Motif Databaseuniprobe mouse |
||||||||||||||
Spacings of "CASAGM (DREME)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: CASAGM (DREME) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
CAGAGC
|
6.9 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif12632Motif Databasedreme.xml |
||||||||||
Spacings of "AGRTGGCA (DREME)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: AGRTGGCA (DREME) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
AGATGGCA
|
7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif819Motif Databasedreme.xml |
||||||||||
Spacings of "MA0469.1 (E2F3)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: MA0469.1 (E2F3) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
CTCCCGCCCCCACTC
|
7.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2493Motif DatabaseJASPAR CORE 2014 vertebrates |
||||||||||
Spacings of "MA0161.1 (NFIC)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: MA0161.1 (NFIC) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
TTGGCA
|
7.6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif14405Motif DatabaseJASPAR CORE 2014 vertebrates |
||||||||||
Spacings of "UP00123 1 (Hlxb9 3422.1)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: UP00123 1 (Hlxb9 3422.1) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
GTACTAATTAGTGGCG
|
7.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1730Motif Databaseuniprobe mouse |
||||||||||
Spacings of "UP00255 1 (Dbx1 3486.1)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: UP00255 1 (Dbx1 3486.1) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
TAATTAATTAATAATTA
|
8.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6331Motif Databaseuniprobe mouse |
||||||||||
Spacings of "UP00074 2 (Isgf3g secondary)" relative to "MA0007.2 (AR)" |
Previous Next Top |
| Primary: MA0007.2 (AR) | Secondary: UP00074 2 (Isgf3g secondary) | E-value |
|---|---|---|
|
AAGAACAGAATGTTC
|
GCAAAACATTACTA
|
8.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8221Motif Databaseuniprobe mouse |
||||||||||