The name of the primary motif.
The logo of the primary motif.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The number of secondary motifs found that had significant spacings in the tested region.
The list of secondary motifs found that had significant spacings in the tested region.
The name of the sequence database.
The last modified date of the sequence database.
The number of sequences in the sequence database.
The number of sequences in the sequence database which were excluded because they were shorter than twice the margin plus the primary motif length.
The number of sequences in the sequence database which were excluded because no match to the primary motif could be found at a distance to the edges larger than the margin.
The number of sequences in the sequence database which were excluded because they were largly identical to other sequences when aligned on the primary motif site.
The number of sequences which were scanned with the secondary motifs.
The name of the motif database derived from the file name.
The date that the motif database was last modified.
The number of motifs loaded from the motif database. Some motifs may have been excluded.
The number of motifs with significant E-values whose significant spacings were not considered too similar to those of another motif.
The number of motifs that while having significant spacings were less signficant than another motif that matched most of the same sites.
The primary motif is used as the reference point for all spacing calculation.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The secondary motif occurs at the spacings relative to the primary shown in the histogram below.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The E-value is the lowest p-value of any spacing of the secondary motif times the number of secondary motifs. It estimates the expected number of random secondary motifs that would have the observed minimum p-value or less.
The histogram below shows the frequency of spacings from the primary motif to the secondary motif. Red bars indicate that a spacing has occured a statistically significant number of times.
The details of the significant spacings are shown in the four quadrants as they relate to the quadrants of the graph.
The total number of sequences that have a match for both the primary motif and this secondary motif.
The motif database which this secondary motif came from.
The list of secondary motifs which have been identified as possibly similar to this motif because their most significant spacings overlaped with the most significant spacing of this motif. Check the boxes to show the possibly similar secondary motifs.
This shows the first secondary motif aligned with the current secondary motif by the most significant spacing.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
For further information on how to interpret these results or to get a copy of the MEME software please access http://meme.nbcr.net.
If you use SpaMo in your research please cite the following paper:
Tom Whitington, Martin C. Frith, James Johnson and Timothy L. Bailey,
"Inferring transcription factor complexes from ChIP-seq data",
Nucleic Acids Research, 39(15):e98, 2011.
[full text]
Primary Motif |
Next Top |
| Name | Preview | Significant Secondaries | List |
|---|---|---|---|
| CTGTAAYY (DREME) |
CTGTAACT
|
64 | MA0139.1 (CTCF), ARAGGGCA (DREME), CCBGCCTC (DREME), AGGCDGAG (DREME), CCABCTCC (DREME), MA0503.1 (Nkx2-5), MA0122.1 (Nkx3-2), MA0525.1 (TP63), MA0141.2 (Esrrb), UP00035 1 (Hic1 primary), MA0478.1 (FOSL2), MA0513.1 (SMAD2::SMAD3::SMAD4), UP00041 2 (Foxj1 secondary), MA0071.1 (RORA 1), UP00231 1 (Nkx2-2 2823.1), UP00069 2 (Sox1 secondary), RAGKTCA (DREME), MA0056.1 (MZF1 1-4), UP00026 2 (Zscan4 secondary), AGGHCA (DREME) |
Sequence Database |
Previous Next Top |
| Name | Last Modified | Loaded | Too Short | No Primary | Too Similar | Used |
|---|---|---|---|---|---|---|
| Static Sex-independent | Wed Jun 7 10:47:08 2017 | 67058 | 0 | 65077 | 0 | 1981 |
Secondary Databases |
Previous Next Top |
| Name | Last Modified | Number of Motifs | Motifs Significant | Motifs Redundant |
|---|---|---|---|---|
| meme.xml | Wed Jun 7 10:49:30 2017 | 3 | 0 | 0 |
| dreme.xml | Wed Jun 7 15:52:22 2017 | 62 | 11 | 0 |
| JASPAR CORE 2014 vertebrates | Wed Jun 7 10:46:42 2017 | 205 | 34 | 9 |
| uniprobe mouse | Wed Jun 7 10:46:42 2017 | 386 | 19 | 5 |
Spacings of "MA0139.1 (CTCF)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: MA0139.1 (CTCF) | E-value |
|---|---|---|
|
CTGTAACT
|
TGGCCACCAGGGGGCGCTA
|
9.5e-26 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif397Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||||||
Spacings of "ARAGGGCA (DREME)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: ARAGGGCA (DREME) | E-value |
|---|---|---|
|
CTGTAACT
|
AGAGGGCA
|
9.3e-16 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif165Motif Databasedreme.xml |
|||||||||||||||||||
Spacings of "CCBGCCTC (DREME)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: CCBGCCTC (DREME) | E-value |
|---|---|---|
|
CTGTAACT
|
CCTGCCTC
|
4.2e-15 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif182Motif Databasedreme.xml |
|||||||||||
Spacings of "AGGCDGAG (DREME)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: AGGCDGAG (DREME) | E-value |
|---|---|---|
|
CTGTAACT
|
AGGCTGAG
|
8e-14 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif221Motif Databasedreme.xml |
|||||||||||
Spacings of "CCABCTCC (DREME)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: CCABCTCC (DREME) | E-value |
|---|---|---|
|
CTGTAACT
|
CCACCTCC
|
6.6e-13 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif197Motif Databasedreme.xml |
|||||||||||||||||||
Spacings of "MA0503.1 (Nkx2-5)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: MA0503.1 (Nkx2-5) | E-value |
|---|---|---|
|
CTGTAACT
|
AGCCACTCAAG
|
4.7e-12 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif715Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0122.1 (Nkx3-2)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: MA0122.1 (Nkx3-2) | E-value |
|---|---|---|
|
CTGTAACT
|
TTAAGTGGA
|
9.4e-11 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1402Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0525.1 (TP63)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: MA0525.1 (TP63) | E-value |
|---|---|---|
|
CTGTAACT
|
AGACATGCCCAGACATGCCC
|
9.5e-11 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif499Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0141.2 (Esrrb)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: MA0141.2 (Esrrb) | E-value |
|---|---|---|
|
CTGTAACT
|
AGCTCAAGGTCA
|
4.3e-10 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif920Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||
| Similar Secondary: MA0505.1 (Nr5a2) | |||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif692Alignment by most significant spacings
|
|||||||||||||||||||||||
| Similar Secondary: UP00079 1 (Esrra primary) | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif710Alignment by most significant spacings
|
|||||||||||||||||||
| Similar Secondary: MA0592.1 (ESRRA) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif667Alignment by most significant spacings
|
|||||||||||||||
| Similar Secondary: UP00009 1 (Nr2f2 primary) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif905Alignment by most significant spacings
|
|||||||||||||||
| Similar Secondary: UP00048 1 (Rara primary) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif863Alignment by most significant spacings
|
|||||||||||||||
Spacings of "UP00035 1 (Hic1 primary)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: UP00035 1 (Hic1 primary) | E-value |
|---|---|---|
|
CTGTAACT
|
ACTATGCCAACCTACC
|
1.1e-09 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif611Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0478.1 (FOSL2)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: MA0478.1 (FOSL2) | E-value |
|---|---|---|
|
CTGTAACT
|
GGATGACTCAT
|
1.7e-06 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif360Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||||||
Spacings of "MA0513.1 (SMAD2::SMAD3::SMAD4)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: MA0513.1 (SMAD2::SMAD3::SMAD4) | E-value |
|---|---|---|
|
CTGTAACT
|
CTGTCTGTCACCT
|
1.7e-06 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif682Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00041 2 (Foxj1 secondary)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: UP00041 2 (Foxj1 secondary) | E-value |
|---|---|---|
|
CTGTAACT
|
ATGTCACAACAACAC
|
3.1e-06 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1016Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0071.1 (RORA 1)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: MA0071.1 (RORA 1) | E-value |
|---|---|---|
|
CTGTAACT
|
ATCAAGGTCA
|
3.4e-06 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif601Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||
Spacings of "UP00231 1 (Nkx2-2 2823.1)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: UP00231 1 (Nkx2-2 2823.1) | E-value |
|---|---|---|
|
CTGTAACT
|
TTAACCACTTGAAAATT
|
5.5e-06 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif499Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00069 2 (Sox1 secondary)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: UP00069 2 (Sox1 secondary) | E-value |
|---|---|---|
|
CTGTAACT
|
CTATAATTGTTATCG
|
8.9e-06 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif928Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "RAGKTCA (DREME)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: RAGKTCA (DREME) | E-value |
|---|---|---|
|
CTGTAACT
|
AAGGTCA
|
9.7e-06 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif664Motif Databasedreme.xml |
|||||||||||||||
| Similar Secondary: MA0158.1 (HOXA5) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1154Alignment by most significant spacings
|
|||||||||||||||
Spacings of "MA0056.1 (MZF1 1-4)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: MA0056.1 (MZF1 1-4) | E-value |
|---|---|---|
|
CTGTAACT
|
TGGGGA
|
3.1e-05 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1037Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00026 2 (Zscan4 secondary)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: UP00026 2 (Zscan4 secondary) | E-value |
|---|---|---|
|
CTGTAACT
|
CGAAGCACACAAAATA
|
3.2e-05 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1006Motif Databaseuniprobe mouse |
|||||||||||||||
Spacings of "AGGHCA (DREME)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: AGGHCA (DREME) | E-value |
|---|---|---|
|
CTGTAACT
|
AGGCCA
|
5.6e-05 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1243Motif Databasedreme.xml |
|||||||||||||||||||
| Similar Secondary: MA0145.2 (Tcfcp2l1) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif797Alignment by most significant spacings
|
|||||||||||||||
Spacings of "MA0494.1 (Nr1h3::Rxra)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: MA0494.1 (Nr1h3::Rxra) | E-value |
|---|---|---|
|
CTGTAACT
|
TGACCTAAAGTAACCTCTG
|
7.8e-05 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif604Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "WGCCAR (DREME)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: WGCCAR (DREME) | E-value |
|---|---|---|
|
CTGTAACT
|
AGCCAG
|
0.00013 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1499Motif Databasedreme.xml |
|||||||||||||||||||
| Similar Secondary: MA0092.1 (Hand1::Tcfe2a) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1259Alignment by most significant spacings
|
|||||||||||||||
Spacings of "MA0103.2 (ZEB1)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: MA0103.2 (ZEB1) | E-value |
|---|---|---|
|
CTGTAACT
|
CCTCACCTG
|
0.00024 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif333Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0144.2 (STAT3)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: MA0144.2 (STAT3) | E-value |
|---|---|---|
|
CTGTAACT
|
CTTCTGGGAAA
|
0.00029 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif701Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
| Similar Secondary: MA0137.3 (STAT1) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif437Alignment by most significant spacings
|
|||||||||||||||
Spacings of "MA0154.2 (EBF1)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: MA0154.2 (EBF1) | E-value |
|---|---|---|
|
CTGTAACT
|
GTCCCCAGGGA
|
0.00053 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif597Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||||||||||
Spacings of "MA0147.2 (Myc)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: MA0147.2 (Myc) | E-value |
|---|---|---|
|
CTGTAACT
|
CCATGTGCTT
|
0.00057 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif360Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
| Similar Secondary: MA0059.1 (MYC::MAX) | |||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif288Alignment by most significant spacings
|
|||||||||||||||||||||||
Spacings of "UP00022 2 (Zfp740 secondary)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: UP00022 2 (Zfp740 secondary) | E-value |
|---|---|---|
|
CTGTAACT
|
AAATTCCCCCCGGAAGT
|
0.0015 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif387Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0512.1 (Rxra)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: MA0512.1 (Rxra) | E-value |
|---|---|---|
|
CTGTAACT
|
CAAAGGTCAGA
|
0.0015 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1143Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||||||
Spacings of "MA0058.2 (MAX)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: MA0058.2 (MAX) | E-value |
|---|---|---|
|
CTGTAACT
|
AAGCACATGG
|
0.0034 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif434Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||
| Similar Secondary: UP00050 1 (Bhlhb2 primary) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif229Alignment by most significant spacings
|
|||||||||||||||
| Similar Secondary: MA0104.3 (Mycn) | |||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif348Alignment by most significant spacings
|
|||||||||||||||||||||||||||
Spacings of "UP00099 1 (Ascl2 primary)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: UP00099 1 (Ascl2 primary) | E-value |
|---|---|---|
|
CTGTAACT
|
CTCAGCAGCTGCTCCTG
|
0.0035 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif866Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0524.1 (TFAP2C)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: MA0524.1 (TFAP2C) | E-value |
|---|---|---|
|
CTGTAACT
|
CATGGCCCCAGGGCA
|
0.004 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif718Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0083.2 (SRF)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: MA0083.2 (SRF) | E-value |
|---|---|---|
|
CTGTAACT
|
CATGCCCAAATAAGGCAA
|
0.0044 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif318Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "GCCATGK (DREME)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: GCCATGK (DREME) | E-value |
|---|---|---|
|
CTGTAACT
|
GCCATGG
|
0.018 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif185Motif Databasedreme.xml |
|||||||||||
| Similar Secondary: UP00060 1 (Max primary) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif400Alignment by most significant spacings
|
|||||||||||||||
| Similar Secondary: MA0526.1 (USF2) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif398Alignment by most significant spacings
|
|||||||||||||||
Spacings of "UP00015 2 (Ehf secondary)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: UP00015 2 (Ehf secondary) | E-value |
|---|---|---|
|
CTGTAACT
|
TAGTATTTCCGATCTT
|
0.048 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif705Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "CYGCCDCC (DREME)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: CYGCCDCC (DREME) | E-value |
|---|---|---|
|
CTGTAACT
|
CTGCCGCC
|
0.063 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif221Motif Databasedreme.xml |
|||||||||||||||
Spacings of "MA0519.1 (Stat5a::Stat5b)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: MA0519.1 (Stat5a::Stat5b) | E-value |
|---|---|---|
|
CTGTAACT
|
ATTTCCAAGAA
|
0.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif630Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00103 2 (Jundm2 secondary)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: UP00103 2 (Jundm2 secondary) | E-value |
|---|---|---|
|
CTGTAACT
|
ATTGATGAGTCACCAA
|
0.29 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif397Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00103 1 (Jundm2 primary)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: UP00103 1 (Jundm2 primary) | E-value |
|---|---|---|
|
CTGTAACT
|
CCGATGACGTCATCGT
|
0.34 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif174Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0160.1 (NR4A2)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: MA0160.1 (NR4A2) | E-value |
|---|---|---|
|
CTGTAACT
|
AAGGTCAC
|
0.49 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1358Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||||||||||
Spacings of "UP00035 2 (Hic1 secondary)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: UP00035 2 (Hic1 secondary) | E-value |
|---|---|---|
|
CTGTAACT
|
GGGTGTGCCCAAAAGG
|
0.62 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif777Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "MA0511.1 (RUNX2)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: MA0511.1 (RUNX2) | E-value |
|---|---|---|
|
CTGTAACT
|
GGGGTTTGTGGTTTG
|
0.64 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif760Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0516.1 (SP2)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: MA0516.1 (SP2) | E-value |
|---|---|---|
|
CTGTAACT
|
GCCCCGCCCCCTCCC
|
0.94 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif800Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0492.1 (JUND)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: MA0492.1 (JUND) | E-value |
|---|---|---|
|
CTGTAACT
|
AAAGATGATGTCATC
|
1.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif214Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00005 2 (Tcfap2a secondary)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: UP00005 2 (Tcfap2a secondary) | E-value |
|---|---|---|
|
CTGTAACT
|
TCACCTCTGGGCAG
|
1.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1012Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00044 2 (Mafk secondary)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: UP00044 2 (Mafk secondary) | E-value |
|---|---|---|
|
CTGTAACT
|
GAAAAAATTGCAAGG
|
2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif859Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0095.2 (YY1)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: MA0095.2 (YY1) | E-value |
|---|---|---|
|
CTGTAACT
|
CAAGATGGCGGC
|
2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif365Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0099.2 (JUN::FOS)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: MA0099.2 (JUN::FOS) | E-value |
|---|---|---|
|
CTGTAACT
|
TGACTCA
|
2.3 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1116Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00068 1 (Eomes primary)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: UP00068 1 (Eomes primary) | E-value |
|---|---|---|
|
CTGTAACT
|
TAAAAGGTGTGAAAATT
|
2.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif533Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0515.1 (Sox6)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: MA0515.1 (Sox6) | E-value |
|---|---|---|
|
CTGTAACT
|
CCATTGTTTT
|
2.5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif534Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "CHGGRA (DREME)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: CHGGRA (DREME) | E-value |
|---|---|---|
|
CTGTAACT
|
CTGGGA
|
2.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1617Motif Databasedreme.xml |
|||||||||||
Spacings of "MA0116.1 (Zfp423)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: MA0116.1 (Zfp423) | E-value |
|---|---|---|
|
CTGTAACT
|
GGCACCCAGGGGTGC
|
2.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif67Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0006.1 (Arnt::Ahr)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: MA0006.1 (Arnt::Ahr) | E-value |
|---|---|---|
|
CTGTAACT
|
TGCGTG
|
2.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif398Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0043.1 (HLF)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: MA0043.1 (HLF) | E-value |
|---|---|---|
|
CTGTAACT
|
GGTTACGCAATC
|
3.3 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif557Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00042 1 (Gm397 primary)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: UP00042 1 (Gm397 primary) | E-value |
|---|---|---|
|
CTGTAACT
|
CAGATGTGCACATACGT
|
4.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif411Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00081 2 (Mybl1 secondary)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: UP00081 2 (Mybl1 secondary) | E-value |
|---|---|---|
|
CTGTAACT
|
CGACCAACTGCCGTG
|
4.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif586Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0033.1 (FOXL1)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: MA0033.1 (FOXL1) | E-value |
|---|---|---|
|
CTGTAACT
|
TATACATA
|
4.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif984Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00005 1 (Tcfap2a primary)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: UP00005 1 (Tcfap2a primary) | E-value |
|---|---|---|
|
CTGTAACT
|
ATTCCCTGAGGGGAA
|
5.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif593Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00089 2 (Tcf1 secondary)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: UP00089 2 (Tcf1 secondary) | E-value |
|---|---|---|
|
CTGTAACT
|
TTGCCCGGATTAGG
|
5.9 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif603Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00020 1 (Atf1 primary)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: UP00020 1 (Atf1 primary) | E-value |
|---|---|---|
|
CTGTAACT
|
ACGATGACGTCATCGA
|
6.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif175Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0019.1 (Ddit3::Cebpa)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: MA0019.1 (Ddit3::Cebpa) | E-value |
|---|---|---|
|
CTGTAACT
|
AGATGCAATCCC
|
6.9 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif617Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0482.1 (Gata4)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: MA0482.1 (Gata4) | E-value |
|---|---|---|
|
CTGTAACT
|
TCTTATCTCCC
|
8.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif466Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0136.1 (ELF5)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: MA0136.1 (ELF5) | E-value |
|---|---|---|
|
CTGTAACT
|
TACTTCCTT
|
8.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1540Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "CTGGGYW (DREME)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: CTGGGYW (DREME) | E-value |
|---|---|---|
|
CTGTAACT
|
CTGGGCT
|
9.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif654Motif Databasedreme.xml |
|||||||||||
Spacings of "MA0076.2 (ELK4)" relative to "CTGTAAYY (DREME)" |
Previous Next Top |
| Primary: CTGTAAYY (DREME) | Secondary: MA0076.2 (ELK4) | E-value |
|---|---|---|
|
CTGTAACT
|
CCACTTCCGGC
|
9.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif652Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||