The name of the primary motif.
The logo of the primary motif.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The number of secondary motifs found that had significant spacings in the tested region.
The list of secondary motifs found that had significant spacings in the tested region.
The name of the sequence database.
The last modified date of the sequence database.
The number of sequences in the sequence database.
The number of sequences in the sequence database which were excluded because they were shorter than twice the margin plus the primary motif length.
The number of sequences in the sequence database which were excluded because no match to the primary motif could be found at a distance to the edges larger than the margin.
The number of sequences in the sequence database which were excluded because they were largly identical to other sequences when aligned on the primary motif site.
The number of sequences which were scanned with the secondary motifs.
The name of the motif database derived from the file name.
The date that the motif database was last modified.
The number of motifs loaded from the motif database. Some motifs may have been excluded.
The number of motifs with significant E-values whose significant spacings were not considered too similar to those of another motif.
The number of motifs that while having significant spacings were less signficant than another motif that matched most of the same sites.
The primary motif is used as the reference point for all spacing calculation.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The secondary motif occurs at the spacings relative to the primary shown in the histogram below.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The E-value is the lowest p-value of any spacing of the secondary motif times the number of secondary motifs. It estimates the expected number of random secondary motifs that would have the observed minimum p-value or less.
The histogram below shows the frequency of spacings from the primary motif to the secondary motif. Red bars indicate that a spacing has occured a statistically significant number of times.
The details of the significant spacings are shown in the four quadrants as they relate to the quadrants of the graph.
The total number of sequences that have a match for both the primary motif and this secondary motif.
The motif database which this secondary motif came from.
The list of secondary motifs which have been identified as possibly similar to this motif because their most significant spacings overlaped with the most significant spacing of this motif. Check the boxes to show the possibly similar secondary motifs.
This shows the first secondary motif aligned with the current secondary motif by the most significant spacing.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
For further information on how to interpret these results or to get a copy of the MEME software please access http://meme.nbcr.net.
If you use SpaMo in your research please cite the following paper:
Tom Whitington, Martin C. Frith, James Johnson and Timothy L. Bailey,
"Inferring transcription factor complexes from ChIP-seq data",
Nucleic Acids Research, 39(15):e98, 2011.
[full text]
Primary Motif |
Next Top |
| Name | Preview | Significant Secondaries | List |
|---|---|---|---|
| 1 (MEME) |
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
37 | MA0528.1 (ZNF263), UP00021 1 (Zfp281 primary), MA0079.3 (SP1), UP00002 1 (Sp4 primary), UP00096 2 (Sox13 secondary), MA0162.2 (EGR1), MA0599.1 (KLF5), UP00065 1 (Zfp161 primary), UP00022 1 (Zfp740 primary), UP00043 2 (Bcl6b secondary), MA0472.1 (EGR2), UP00407 2 (Elf3 secondary), UP00391 2 (Hoxa3 secondary), CYCCDCCC (DREME), UP00033 2 (Zfp410 secondary), UP00007 2 (Egr1 secondary), UP00222 1 (Tcf2 0913.2), UP00002 2 (Sp4 secondary), MA0039.2 (Klf4), MA0060.2 (NFYA) |
Sequence Database |
Previous Next Top |
| Name | Last Modified | Loaded | Too Short | No Primary | Too Similar | Used |
|---|---|---|---|---|---|---|
| Static Sex-independent | Wed Jun 7 10:47:08 2017 | 67058 | 0 | 52883 | 5 | 14170 |
Secondary Databases |
Previous Next Top |
| Name | Last Modified | Number of Motifs | Motifs Significant | Motifs Redundant |
|---|---|---|---|---|
| meme.xml | Wed Jun 7 10:49:30 2017 | 2 | 0 | 0 |
| dreme.xml | Wed Jun 7 15:52:22 2017 | 63 | 4 | 0 |
| JASPAR CORE 2014 vertebrates | Wed Jun 7 10:46:42 2017 | 205 | 12 | 1 |
| uniprobe mouse | Wed Jun 7 10:46:42 2017 | 386 | 21 | 1 |
Spacings of "MA0528.1 (ZNF263)" relative to "1 (MEME)" |
Previous Next Top |
| Primary: 1 (MEME) | Secondary: MA0528.1 (ZNF263) | E-value |
|---|---|---|
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
GGAGGAGGAGGGGGAGGAGGA
|
4e-06 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8128Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||||||||||||||||||||||||||
Spacings of "UP00021 1 (Zfp281 primary)" relative to "1 (MEME)" |
Previous Next Top |
| Primary: 1 (MEME) | Secondary: UP00021 1 (Zfp281 primary) | E-value |
|---|---|---|
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
TCCCCCCCCCCCCCC
|
0.00029 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7933Motif Databaseuniprobe mouse |
|||||||||||||||||||||||||||
Spacings of "MA0079.3 (SP1)" relative to "1 (MEME)" |
Previous Next Top |
| Primary: 1 (MEME) | Secondary: MA0079.3 (SP1) | E-value |
|---|---|---|
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
GCCCCGCCCCC
|
0.0012 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif9822Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||||||||||||||||||
| Similar Secondary: MA0516.1 (SP2) | |||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif10156Alignment by most significant spacings
|
|||||||||||||||||||||||||||||||||||
Spacings of "UP00002 1 (Sp4 primary)" relative to "1 (MEME)" |
Previous Next Top |
| Primary: 1 (MEME) | Secondary: UP00002 1 (Sp4 primary) | E-value |
|---|---|---|
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
GGTCCCGCCCCCTTCTC
|
0.033 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8247Motif Databaseuniprobe mouse |
|||||||||||||||||||||||
Spacings of "UP00096 2 (Sox13 secondary)" relative to "1 (MEME)" |
Previous Next Top |
| Primary: 1 (MEME) | Secondary: UP00096 2 (Sox13 secondary) | E-value |
|---|---|---|
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
GTATTGGGTGGGTATTT
|
0.06 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif9816Motif Databaseuniprobe mouse |
|||||||||||||||||||||||||||
Spacings of "MA0162.2 (EGR1)" relative to "1 (MEME)" |
Previous Next Top |
| Primary: 1 (MEME) | Secondary: MA0162.2 (EGR1) | E-value |
|---|---|---|
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
CCCCCGCCCCCGCC
|
0.076 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif9087Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0599.1 (KLF5)" relative to "1 (MEME)" |
Previous Next Top |
| Primary: 1 (MEME) | Secondary: MA0599.1 (KLF5) | E-value |
|---|---|---|
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
GCCCCGCCCC
|
0.092 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif9279Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||||||
Spacings of "UP00065 1 (Zfp161 primary)" relative to "1 (MEME)" |
Previous Next Top |
| Primary: 1 (MEME) | Secondary: UP00065 1 (Zfp161 primary) | E-value |
|---|---|---|
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
TGGCGCGCGCGCCTGA
|
0.13 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4793Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00022 1 (Zfp740 primary)" relative to "1 (MEME)" |
Previous Next Top |
| Primary: 1 (MEME) | Secondary: UP00022 1 (Zfp740 primary) | E-value |
|---|---|---|
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
CCCCCCCCCCCACTTG
|
0.16 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6819Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "UP00043 2 (Bcl6b secondary)" relative to "1 (MEME)" |
Previous Next Top |
| Primary: 1 (MEME) | Secondary: UP00043 2 (Bcl6b secondary) | E-value |
|---|---|---|
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
ATCCCCGCCCCTAAAA
|
0.17 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif11451Motif Databaseuniprobe mouse |
|||||||||||||||||||||||
Spacings of "MA0472.1 (EGR2)" relative to "1 (MEME)" |
Previous Next Top |
| Primary: 1 (MEME) | Secondary: MA0472.1 (EGR2) | E-value |
|---|---|---|
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
CCCCCGCCCACGCAC
|
0.23 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7213Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00407 2 (Elf3 secondary)" relative to "1 (MEME)" |
Previous Next Top |
| Primary: 1 (MEME) | Secondary: UP00407 2 (Elf3 secondary) | E-value |
|---|---|---|
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
GTTCAAAAAAAAAATTC
|
0.32 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2904Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00391 2 (Hoxa3 secondary)" relative to "1 (MEME)" |
Previous Next Top |
| Primary: 1 (MEME) | Secondary: UP00391 2 (Hoxa3 secondary) | E-value |
|---|---|---|
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
AAAAACCATTAAGG
|
0.46 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2000Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "CYCCDCCC (DREME)" relative to "1 (MEME)" |
Previous Next Top |
| Primary: 1 (MEME) | Secondary: CYCCDCCC (DREME) | E-value |
|---|---|---|
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
CCCCTCCC
|
0.53 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6578Motif Databasedreme.xml |
|||||||||||||||
Spacings of "UP00033 2 (Zfp410 secondary)" relative to "1 (MEME)" |
Previous Next Top |
| Primary: 1 (MEME) | Secondary: UP00033 2 (Zfp410 secondary) | E-value |
|---|---|---|
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
TCACCCCGCCCCTAATT
|
0.68 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif11775Motif Databaseuniprobe mouse |
|||||||||||||||||||||||||||
Spacings of "UP00007 2 (Egr1 secondary)" relative to "1 (MEME)" |
Previous Next Top |
| Primary: 1 (MEME) | Secondary: UP00007 2 (Egr1 secondary) | E-value |
|---|---|---|
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
TGCGGAGTGGGACTGG
|
0.82 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8766Motif Databaseuniprobe mouse |
|||||||||||||||||||||||
Spacings of "UP00222 1 (Tcf2 0913.2)" relative to "1 (MEME)" |
Previous Next Top |
| Primary: 1 (MEME) | Secondary: UP00222 1 (Tcf2 0913.2) | E-value |
|---|---|---|
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
AGCTGTTAACTAGCCGT
|
0.91 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif975Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00002 2 (Sp4 secondary)" relative to "1 (MEME)" |
Previous Next Top |
| Primary: 1 (MEME) | Secondary: UP00002 2 (Sp4 secondary) | E-value |
|---|---|---|
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
CAAAGGCGTGGCCAG
|
3.3 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7479Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0039.2 (Klf4)" relative to "1 (MEME)" |
Previous Next Top |
| Primary: 1 (MEME) | Secondary: MA0039.2 (Klf4) | E-value |
|---|---|---|
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
TGGGTGGGGC
|
3.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif9343Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||||||
| Similar Secondary: UP00093 1 (Klf7 primary) | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif9377Alignment by most significant spacings
|
|||||||||||||||||||
Spacings of "MA0060.2 (NFYA)" relative to "1 (MEME)" |
Previous Next Top |
| Primary: 1 (MEME) | Secondary: MA0060.2 (NFYA) | E-value |
|---|---|---|
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
AGAGTGCTGATTGGTCCA
|
4.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1554Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00074 2 (Isgf3g secondary)" relative to "1 (MEME)" |
Previous Next Top |
| Primary: 1 (MEME) | Secondary: UP00074 2 (Isgf3g secondary) | E-value |
|---|---|---|
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
GCAAAACATTACTA
|
4.6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3608Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00213 1 (Hoxa9 2622.2)" relative to "1 (MEME)" |
Previous Next Top |
| Primary: 1 (MEME) | Secondary: UP00213 1 (Hoxa9 2622.2) | E-value |
|---|---|---|
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
ACGGCCATAAAATTAAT
|
4.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1599Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00046 1 (Tcfe2a primary)" relative to "1 (MEME)" |
Previous Next Top |
| Primary: 1 (MEME) | Secondary: UP00046 1 (Tcfe2a primary) | E-value |
|---|---|---|
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
ATCCACAGGTGCGAAAA
|
5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5973Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "VGGAAR (DREME)" relative to "1 (MEME)" |
Previous Next Top |
| Primary: 1 (MEME) | Secondary: VGGAAR (DREME) | E-value |
|---|---|---|
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
AGGAAG
|
5.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif11281Motif Databasedreme.xml |
|||||||||||
Spacings of "UP00037 1 (Zfp105 primary)" relative to "1 (MEME)" |
Previous Next Top |
| Primary: 1 (MEME) | Secondary: UP00037 1 (Zfp105 primary) | E-value |
|---|---|---|
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
AACAAACAACAAGAG
|
5.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3650Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00000 2 (Smad3 secondary)" relative to "1 (MEME)" |
Previous Next Top |
| Primary: 1 (MEME) | Secondary: UP00000 2 (Smad3 secondary) | E-value |
|---|---|---|
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
TACGCCCCGCCACTCTG
|
5.5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif10396Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "UP00183 1 (Hoxa13 3126.1)" relative to "1 (MEME)" |
Previous Next Top |
| Primary: 1 (MEME) | Secondary: UP00183 1 (Hoxa13 3126.1) | E-value |
|---|---|---|
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
AAACCTCGTAAAATTT
|
7.5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif625Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00028 2 (Tcfap2e secondary)" relative to "1 (MEME)" |
Previous Next Top |
| Primary: 1 (MEME) | Secondary: UP00028 2 (Tcfap2e secondary) | E-value |
|---|---|---|
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
TACTGGAAAAAAAA
|
7.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4381Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "GGGMGGGA (DREME)" relative to "1 (MEME)" |
Previous Next Top |
| Primary: 1 (MEME) | Secondary: GGGMGGGA (DREME) | E-value |
|---|---|---|
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
GGGAGGGA
|
8.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2038Motif Databasedreme.xml |
|||||||||||
Spacings of "UP00023 1 (Sox30 primary)" relative to "1 (MEME)" |
Previous Next Top |
| Primary: 1 (MEME) | Secondary: UP00023 1 (Sox30 primary) | E-value |
|---|---|---|
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
ATTGAACAATGGAATT
|
9 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2910Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "TTATYW (DREME)" relative to "1 (MEME)" |
Previous Next Top |
| Primary: 1 (MEME) | Secondary: TTATYW (DREME) | E-value |
|---|---|---|
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
TTATCT
|
9 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2362Motif Databasedreme.xml |
|||||||||||
Spacings of "MA0098.2 (Ets1)" relative to "1 (MEME)" |
Previous Next Top |
| Primary: 1 (MEME) | Secondary: MA0098.2 (Ets1) | E-value |
|---|---|---|
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
CCCACTTCCTGTCTC
|
9.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6415Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0469.1 (E2F3)" relative to "1 (MEME)" |
Previous Next Top |
| Primary: 1 (MEME) | Secondary: MA0469.1 (E2F3) | E-value |
|---|---|---|
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
CTCCCGCCCCCACTC
|
9.3 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4991Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0057.1 (MZF1 5-13)" relative to "1 (MEME)" |
Previous Next Top |
| Primary: 1 (MEME) | Secondary: MA0057.1 (MZF1 5-13) | E-value |
|---|---|---|
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
GGAGGGGGAA
|
9.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif9131Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00031 1 (Zbtb3 primary)" relative to "1 (MEME)" |
Previous Next Top |
| Primary: 1 (MEME) | Secondary: UP00031 1 (Zbtb3 primary) | E-value |
|---|---|---|
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
AATCGCACTGCATTCCG
|
9.5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5896Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0145.2 (Tcfcp2l1)" relative to "1 (MEME)" |
Previous Next Top |
| Primary: 1 (MEME) | Secondary: MA0145.2 (Tcfcp2l1) | E-value |
|---|---|---|
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
CCAGTTCAAACCAG
|
9.6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6996Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0504.1 (NR2C2)" relative to "1 (MEME)" |
Previous Next Top |
| Primary: 1 (MEME) | Secondary: MA0504.1 (NR2C2) | E-value |
|---|---|---|
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
AGGGGTCAGAGGTCA
|
9.6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4012Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||