The name of the primary motif.
The logo of the primary motif.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The number of secondary motifs found that had significant spacings in the tested region.
The list of secondary motifs found that had significant spacings in the tested region.
The name of the sequence database.
The last modified date of the sequence database.
The number of sequences in the sequence database.
The number of sequences in the sequence database which were excluded because they were shorter than twice the margin plus the primary motif length.
The number of sequences in the sequence database which were excluded because no match to the primary motif could be found at a distance to the edges larger than the margin.
The number of sequences in the sequence database which were excluded because they were largly identical to other sequences when aligned on the primary motif site.
The number of sequences which were scanned with the secondary motifs.
The name of the motif database derived from the file name.
The date that the motif database was last modified.
The number of motifs loaded from the motif database. Some motifs may have been excluded.
The number of motifs with significant E-values whose significant spacings were not considered too similar to those of another motif.
The number of motifs that while having significant spacings were less signficant than another motif that matched most of the same sites.
The primary motif is used as the reference point for all spacing calculation.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The secondary motif occurs at the spacings relative to the primary shown in the histogram below.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The E-value is the lowest p-value of any spacing of the secondary motif times the number of secondary motifs. It estimates the expected number of random secondary motifs that would have the observed minimum p-value or less.
The histogram below shows the frequency of spacings from the primary motif to the secondary motif. Red bars indicate that a spacing has occured a statistically significant number of times.
The details of the significant spacings are shown in the four quadrants as they relate to the quadrants of the graph.
The total number of sequences that have a match for both the primary motif and this secondary motif.
The motif database which this secondary motif came from.
The list of secondary motifs which have been identified as possibly similar to this motif because their most significant spacings overlaped with the most significant spacing of this motif. Check the boxes to show the possibly similar secondary motifs.
This shows the first secondary motif aligned with the current secondary motif by the most significant spacing.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
For further information on how to interpret these results or to get a copy of the MEME software please access http://meme.nbcr.net.
If you use SpaMo in your research please cite the following paper:
Tom Whitington, Martin C. Frith, James Johnson and Timothy L. Bailey,
"Inferring transcription factor complexes from ChIP-seq data",
Nucleic Acids Research, 39(15):e98, 2011.
[full text]
Primary Motif |
Next Top |
| Name | Preview | Significant Secondaries | List |
|---|---|---|---|
| UP00068 2 (Eomes secondary) |
GCGGAGGTGTCGCCTC
|
25 | STGGCCA (DREME), MA0133.1 (BRCA1), UP00022 1 (Zfp740 primary), UP00077 2 (Srf secondary), UP00047 2 (Zbtb7b secondary), UP00164 1 (Hoxa7 2668.2), UP00037 1 (Zfp105 primary), MA0114.2 (HNF4A), UP00407 2 (Elf3 secondary), UP00096 1 (Sox13 primary), UP00168 1 (Hoxd8 2644.1), MA0019.1 (Ddit3::Cebpa), MA0130.1 (ZNF354C), UP00000 2 (Smad3 secondary), AAARMAAA (DREME), GCCATGK (DREME), 1 (MEME), UP00021 1 (Zfp281 primary), MA0063.1 (Nkx2-5), UP00040 1 (Irf5 primary) |
Sequence Database |
Previous Next Top |
| Name | Last Modified | Loaded | Too Short | No Primary | Too Similar | Used |
|---|---|---|---|---|---|---|
| Static Sex-independent | Wed Jun 7 10:47:08 2017 | 67058 | 0 | 49837 | 1 | 17220 |
Secondary Databases |
Previous Next Top |
| Name | Last Modified | Number of Motifs | Motifs Significant | Motifs Redundant |
|---|---|---|---|---|
| meme.xml | Wed Jun 7 10:49:30 2017 | 3 | 1 | 0 |
| dreme.xml | Wed Jun 7 15:52:22 2017 | 63 | 3 | 0 |
| JASPAR CORE 2014 vertebrates | Wed Jun 7 10:46:42 2017 | 205 | 6 | 1 |
| uniprobe mouse | Wed Jun 7 10:46:42 2017 | 385 | 15 | 0 |
Spacings of "STGGCCA (DREME)" relative to "UP00068 2 (Eomes secondary)" |
Previous Next Top |
| Primary: UP00068 2 (Eomes secondary) | Secondary: STGGCCA (DREME) | E-value |
|---|---|---|
|
GCGGAGGTGTCGCCTC
|
CTGGCCA
|
2e-09 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2322Motif Databasedreme.xml |
|||||||||||||||||||
Spacings of "MA0133.1 (BRCA1)" relative to "UP00068 2 (Eomes secondary)" |
Previous Next Top |
| Primary: UP00068 2 (Eomes secondary) | Secondary: MA0133.1 (BRCA1) | E-value |
|---|---|---|
|
GCGGAGGTGTCGCCTC
|
ACAACAC
|
0.00027 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7988Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00022 1 (Zfp740 primary)" relative to "UP00068 2 (Eomes secondary)" |
Previous Next Top |
| Primary: UP00068 2 (Eomes secondary) | Secondary: UP00022 1 (Zfp740 primary) | E-value |
|---|---|---|
|
GCGGAGGTGTCGCCTC
|
CCCCCCCCCCCACTTG
|
0.00079 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6278Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00077 2 (Srf secondary)" relative to "UP00068 2 (Eomes secondary)" |
Previous Next Top |
| Primary: UP00068 2 (Eomes secondary) | Secondary: UP00077 2 (Srf secondary) | E-value |
|---|---|---|
|
GCGGAGGTGTCGCCTC
|
GTTAAAAAAAAAAATTT
|
0.0047 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7691Motif Databaseuniprobe mouse |
|||||||||||||||||||||||||||||||||||||||||||
Spacings of "UP00047 2 (Zbtb7b secondary)" relative to "UP00068 2 (Eomes secondary)" |
Previous Next Top |
| Primary: UP00068 2 (Eomes secondary) | Secondary: UP00047 2 (Zbtb7b secondary) | E-value |
|---|---|---|
|
GCGGAGGTGTCGCCTC
|
CTTAAGACCACCATTAC
|
0.0089 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4539Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00164 1 (Hoxa7 2668.2)" relative to "UP00068 2 (Eomes secondary)" |
Previous Next Top |
| Primary: UP00068 2 (Eomes secondary) | Secondary: UP00164 1 (Hoxa7 2668.2) | E-value |
|---|---|---|
|
GCGGAGGTGTCGCCTC
|
CGAGTTAATTAATAAGC
|
0.021 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4324Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00037 1 (Zfp105 primary)" relative to "UP00068 2 (Eomes secondary)" |
Previous Next Top |
| Primary: UP00068 2 (Eomes secondary) | Secondary: UP00037 1 (Zfp105 primary) | E-value |
|---|---|---|
|
GCGGAGGTGTCGCCTC
|
AACAAACAACAAGAG
|
0.28 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8300Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "MA0114.2 (HNF4A)" relative to "UP00068 2 (Eomes secondary)" |
Previous Next Top |
| Primary: UP00068 2 (Eomes secondary) | Secondary: MA0114.2 (HNF4A) | E-value |
|---|---|---|
|
GCGGAGGTGTCGCCTC
|
CTGGACTTTGGACTC
|
0.29 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7812Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
| Similar Secondary: MA0484.1 (HNF4G) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8162Alignment by most significant spacings
|
|||||||||||||||
Spacings of "UP00407 2 (Elf3 secondary)" relative to "UP00068 2 (Eomes secondary)" |
Previous Next Top |
| Primary: UP00068 2 (Eomes secondary) | Secondary: UP00407 2 (Elf3 secondary) | E-value |
|---|---|---|
|
GCGGAGGTGTCGCCTC
|
GTTCAAAAAAAAAATTC
|
0.58 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7280Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "UP00096 1 (Sox13 primary)" relative to "UP00068 2 (Eomes secondary)" |
Previous Next Top |
| Primary: UP00068 2 (Eomes secondary) | Secondary: UP00096 1 (Sox13 primary) | E-value |
|---|---|---|
|
GCGGAGGTGTCGCCTC
|
TTAAGAACAATAATTT
|
1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5271Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00168 1 (Hoxd8 2644.1)" relative to "UP00068 2 (Eomes secondary)" |
Previous Next Top |
| Primary: UP00068 2 (Eomes secondary) | Secondary: UP00168 1 (Hoxd8 2644.1) | E-value |
|---|---|---|
|
GCGGAGGTGTCGCCTC
|
TAATTAATTAATGGCTA
|
1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3402Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0019.1 (Ddit3::Cebpa)" relative to "UP00068 2 (Eomes secondary)" |
Previous Next Top |
| Primary: UP00068 2 (Eomes secondary) | Secondary: MA0019.1 (Ddit3::Cebpa) | E-value |
|---|---|---|
|
GCGGAGGTGTCGCCTC
|
AGATGCAATCCC
|
2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4626Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0130.1 (ZNF354C)" relative to "UP00068 2 (Eomes secondary)" |
Previous Next Top |
| Primary: UP00068 2 (Eomes secondary) | Secondary: MA0130.1 (ZNF354C) | E-value |
|---|---|---|
|
GCGGAGGTGTCGCCTC
|
ATCCAC
|
2.5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif12885Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00000 2 (Smad3 secondary)" relative to "UP00068 2 (Eomes secondary)" |
Previous Next Top |
| Primary: UP00068 2 (Eomes secondary) | Secondary: UP00000 2 (Smad3 secondary) | E-value |
|---|---|---|
|
GCGGAGGTGTCGCCTC
|
TACGCCCCGCCACTCTG
|
2.6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6779Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "AAARMAAA (DREME)" relative to "UP00068 2 (Eomes secondary)" |
Previous Next Top |
| Primary: UP00068 2 (Eomes secondary) | Secondary: AAARMAAA (DREME) | E-value |
|---|---|---|
|
GCGGAGGTGTCGCCTC
|
AAAAAAAA
|
3.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2695Motif Databasedreme.xml |
|||||||||||
Spacings of "GCCATGK (DREME)" relative to "UP00068 2 (Eomes secondary)" |
Previous Next Top |
| Primary: UP00068 2 (Eomes secondary) | Secondary: GCCATGK (DREME) | E-value |
|---|---|---|
|
GCGGAGGTGTCGCCTC
|
GCCATGG
|
3.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1912Motif Databasedreme.xml |
|||||||||||
Spacings of "1 (MEME)" relative to "UP00068 2 (Eomes secondary)" |
Previous Next Top |
| Primary: UP00068 2 (Eomes secondary) | Secondary: 1 (MEME) | E-value |
|---|---|---|
|
GCGGAGGTGTCGCCTC
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4215Motif Databasememe.xml |
|||||||||||
Spacings of "UP00021 1 (Zfp281 primary)" relative to "UP00068 2 (Eomes secondary)" |
Previous Next Top |
| Primary: UP00068 2 (Eomes secondary) | Secondary: UP00021 1 (Zfp281 primary) | E-value |
|---|---|---|
|
GCGGAGGTGTCGCCTC
|
TCCCCCCCCCCCCCC
|
4.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6725Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0063.1 (Nkx2-5)" relative to "UP00068 2 (Eomes secondary)" |
Previous Next Top |
| Primary: UP00068 2 (Eomes secondary) | Secondary: MA0063.1 (Nkx2-5) | E-value |
|---|---|---|
|
GCGGAGGTGTCGCCTC
|
TTAATTG
|
4.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7784Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00040 1 (Irf5 primary)" relative to "UP00068 2 (Eomes secondary)" |
Previous Next Top |
| Primary: UP00068 2 (Eomes secondary) | Secondary: UP00040 1 (Irf5 primary) | E-value |
|---|---|---|
|
GCGGAGGTGTCGCCTC
|
ATAAACCGAAACCAA
|
4.9 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2183Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "UP00043 2 (Bcl6b secondary)" relative to "UP00068 2 (Eomes secondary)" |
Previous Next Top |
| Primary: UP00068 2 (Eomes secondary) | Secondary: UP00043 2 (Bcl6b secondary) | E-value |
|---|---|---|
|
GCGGAGGTGTCGCCTC
|
ATCCCCGCCCCTAAAA
|
5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif9592Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0512.1 (Rxra)" relative to "UP00068 2 (Eomes secondary)" |
Previous Next Top |
| Primary: UP00068 2 (Eomes secondary) | Secondary: MA0512.1 (Rxra) | E-value |
|---|---|---|
|
GCGGAGGTGTCGCCTC
|
CAAAGGTCAGA
|
5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8787Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00033 2 (Zfp410 secondary)" relative to "UP00068 2 (Eomes secondary)" |
Previous Next Top |
| Primary: UP00068 2 (Eomes secondary) | Secondary: UP00033 2 (Zfp410 secondary) | E-value |
|---|---|---|
|
GCGGAGGTGTCGCCTC
|
TCACCCCGCCCCTAATT
|
6.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif9377Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00026 1 (Zscan4 primary)" relative to "UP00068 2 (Eomes secondary)" |
Previous Next Top |
| Primary: UP00068 2 (Eomes secondary) | Secondary: UP00026 1 (Zscan4 primary) | E-value |
|---|---|---|
|
GCGGAGGTGTCGCCTC
|
TACATGTGCACATAAAA
|
7.5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3428Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "UP00007 1 (Egr1 primary)" relative to "UP00068 2 (Eomes secondary)" |
Previous Next Top |
| Primary: UP00068 2 (Eomes secondary) | Secondary: UP00007 1 (Egr1 primary) | E-value |
|---|---|---|
|
GCGGAGGTGTCGCCTC
|
TCCGCCCCCGCATT
|
8.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5027Motif Databaseuniprobe mouse |
|||||||||||