The name of the primary motif.
The logo of the primary motif.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The number of secondary motifs found that had significant spacings in the tested region.
The list of secondary motifs found that had significant spacings in the tested region.
The name of the sequence database.
The last modified date of the sequence database.
The number of sequences in the sequence database.
The number of sequences in the sequence database which were excluded because they were shorter than twice the margin plus the primary motif length.
The number of sequences in the sequence database which were excluded because no match to the primary motif could be found at a distance to the edges larger than the margin.
The number of sequences in the sequence database which were excluded because they were largly identical to other sequences when aligned on the primary motif site.
The number of sequences which were scanned with the secondary motifs.
The name of the motif database derived from the file name.
The date that the motif database was last modified.
The number of motifs loaded from the motif database. Some motifs may have been excluded.
The number of motifs with significant E-values whose significant spacings were not considered too similar to those of another motif.
The number of motifs that while having significant spacings were less signficant than another motif that matched most of the same sites.
The primary motif is used as the reference point for all spacing calculation.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The secondary motif occurs at the spacings relative to the primary shown in the histogram below.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The E-value is the lowest p-value of any spacing of the secondary motif times the number of secondary motifs. It estimates the expected number of random secondary motifs that would have the observed minimum p-value or less.
The histogram below shows the frequency of spacings from the primary motif to the secondary motif. Red bars indicate that a spacing has occured a statistically significant number of times.
The details of the significant spacings are shown in the four quadrants as they relate to the quadrants of the graph.
The total number of sequences that have a match for both the primary motif and this secondary motif.
The motif database which this secondary motif came from.
The list of secondary motifs which have been identified as possibly similar to this motif because their most significant spacings overlaped with the most significant spacing of this motif. Check the boxes to show the possibly similar secondary motifs.
This shows the first secondary motif aligned with the current secondary motif by the most significant spacing.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
For further information on how to interpret these results or to get a copy of the MEME software please access http://meme.nbcr.net.
If you use SpaMo in your research please cite the following paper:
Tom Whitington, Martin C. Frith, James Johnson and Timothy L. Bailey,
"Inferring transcription factor complexes from ChIP-seq data",
Nucleic Acids Research, 39(15):e98, 2011.
[full text]
Primary Motif |
Next Top |
| Name | Preview | Significant Secondaries | List |
|---|---|---|---|
| UP00065 1 (Zfp161 primary) |
TGGCGCGCGCGCCTGA
|
31 | AGGCDGAG (DREME), UP00089 2 (Tcf1 secondary), 2 (MEME), UP00019 1 (Zbtb12 primary), CCBGCCTC (DREME), TACADA (DREME), CAGGMTG (DREME), UP00042 2 (Gm397 secondary), UP00232 1 (Dobox4 3956.2), UP00002 2 (Sp4 secondary), UP00148 1 (Hdx 3845.3), MA0259.1 (HIF1A::ARNT), MA0472.1 (EGR2), UP00026 1 (Zscan4 primary), MA0150.2 (Nfe2l2), MA0073.1 (RREB1), WGCCAR (DREME), MA0158.1 (HOXA5), UP00001 1 (E2F2 primary), TGACGTMA (DREME) |
Sequence Database |
Previous Next Top |
| Name | Last Modified | Loaded | Too Short | No Primary | Too Similar | Used |
|---|---|---|---|---|---|---|
| Static Sex-independent | Wed Jun 7 10:47:08 2017 | 67058 | 0 | 60708 | 3 | 6347 |
Secondary Databases |
Previous Next Top |
| Name | Last Modified | Number of Motifs | Motifs Significant | Motifs Redundant |
|---|---|---|---|---|
| meme.xml | Wed Jun 7 10:49:30 2017 | 3 | 2 | 0 |
| dreme.xml | Wed Jun 7 15:52:22 2017 | 63 | 7 | 2 |
| JASPAR CORE 2014 vertebrates | Wed Jun 7 10:46:42 2017 | 205 | 8 | 6 |
| uniprobe mouse | Wed Jun 7 10:46:42 2017 | 385 | 14 | 2 |
Spacings of "AGGCDGAG (DREME)" relative to "UP00065 1 (Zfp161 primary)" |
Previous Next Top |
| Primary: UP00065 1 (Zfp161 primary) | Secondary: AGGCDGAG (DREME) | E-value |
|---|---|---|
|
TGGCGCGCGCGCCTGA
|
AGGCTGAG
|
5.4e-12 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif846Motif Databasedreme.xml |
|||||||||||
| Similar Secondary: CYGCCDCC (DREME) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2410Alignment by most significant spacings
|
|||||||||||||||
Spacings of "UP00089 2 (Tcf1 secondary)" relative to "UP00065 1 (Zfp161 primary)" |
Previous Next Top |
| Primary: UP00065 1 (Zfp161 primary) | Secondary: UP00089 2 (Tcf1 secondary) | E-value |
|---|---|---|
|
TGGCGCGCGCGCCTGA
|
TTGCCCGGATTAGG
|
2.4e-10 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1287Motif Databaseuniprobe mouse |
|||||||||||
| Similar Secondary: MA0483.1 (Gfi1b) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1054Alignment by most significant spacings
|
|||||||||||||||
| Similar Secondary: CHGGRA (DREME) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5306Alignment by most significant spacings
|
|||||||||||||||
| Similar Secondary: MA0122.1 (Nkx3-2) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3766Alignment by most significant spacings
|
|||||||||||||||
| Similar Secondary: UP00231 1 (Nkx2-2 2823.1) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif956Alignment by most significant spacings
|
|||||||||||||||
Spacings of "2 (MEME)" relative to "UP00065 1 (Zfp161 primary)" |
Previous Next Top |
| Primary: UP00065 1 (Zfp161 primary) | Secondary: 2 (MEME) | E-value |
|---|---|---|
|
TGGCGCGCGCGCCTGA
|
GTGTGTGTGTG
|
1.2e-07 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||||||||||||||||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1392Motif Databasememe.xml |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
Spacings of "UP00019 1 (Zbtb12 primary)" relative to "UP00065 1 (Zfp161 primary)" |
Previous Next Top |
| Primary: UP00065 1 (Zfp161 primary) | Secondary: UP00019 1 (Zbtb12 primary) | E-value |
|---|---|---|
|
TGGCGCGCGCGCCTGA
|
CTAAGGTTCTAGATCAC
|
3.4e-05 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif462Motif Databaseuniprobe mouse |
|||||||||||
| Similar Secondary: MA0486.1 (HSF1) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1002Alignment by most significant spacings
|
|||||||||||||||
| Similar Secondary: UP00043 1 (Bcl6b primary) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1053Alignment by most significant spacings
|
|||||||||||||||
Spacings of "CCBGCCTC (DREME)" relative to "UP00065 1 (Zfp161 primary)" |
Previous Next Top |
| Primary: UP00065 1 (Zfp161 primary) | Secondary: CCBGCCTC (DREME) | E-value |
|---|---|---|
|
TGGCGCGCGCGCCTGA
|
CCTGCCTC
|
5.6e-05 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1228Motif Databasedreme.xml |
|||||||||||
Spacings of "TACADA (DREME)" relative to "UP00065 1 (Zfp161 primary)" |
Previous Next Top |
| Primary: UP00065 1 (Zfp161 primary) | Secondary: TACADA (DREME) | E-value |
|---|---|---|
|
TGGCGCGCGCGCCTGA
|
TACAAA
|
0.00018 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif996Motif Databasedreme.xml |
|||||||||||
Spacings of "CAGGMTG (DREME)" relative to "UP00065 1 (Zfp161 primary)" |
Previous Next Top |
| Primary: UP00065 1 (Zfp161 primary) | Secondary: CAGGMTG (DREME) | E-value |
|---|---|---|
|
TGGCGCGCGCGCCTGA
|
CAGGCTG
|
0.0017 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1171Motif Databasedreme.xml |
|||||||||||
| Similar Secondary: MA0258.2 (ESR2) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1868Alignment by most significant spacings
|
|||||||||||||||
| Similar Secondary: MA0112.2 (ESR1) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1989Alignment by most significant spacings
|
|||||||||||||||
Spacings of "UP00042 2 (Gm397 secondary)" relative to "UP00065 1 (Zfp161 primary)" |
Previous Next Top |
| Primary: UP00065 1 (Zfp161 primary) | Secondary: UP00042 2 (Gm397 secondary) | E-value |
|---|---|---|
|
TGGCGCGCGCGCCTGA
|
AGCGGCACACACGCAA
|
0.0082 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1892Motif Databaseuniprobe mouse |
|||||||||||||||||||||||||||
Spacings of "UP00232 1 (Dobox4 3956.2)" relative to "UP00065 1 (Zfp161 primary)" |
Previous Next Top |
| Primary: UP00065 1 (Zfp161 primary) | Secondary: UP00232 1 (Dobox4 3956.2) | E-value |
|---|---|---|
|
TGGCGCGCGCGCCTGA
|
TAAATAGATACCCCATA
|
0.03 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif538Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00002 2 (Sp4 secondary)" relative to "UP00065 1 (Zfp161 primary)" |
Previous Next Top |
| Primary: UP00065 1 (Zfp161 primary) | Secondary: UP00002 2 (Sp4 secondary) | E-value |
|---|---|---|
|
TGGCGCGCGCGCCTGA
|
CAAAGGCGTGGCCAG
|
0.061 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3490Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00148 1 (Hdx 3845.3)" relative to "UP00065 1 (Zfp161 primary)" |
Previous Next Top |
| Primary: UP00065 1 (Zfp161 primary) | Secondary: UP00148 1 (Hdx 3845.3) | E-value |
|---|---|---|
|
TGGCGCGCGCGCCTGA
|
AAGGCGAAATCATCGCA
|
0.12 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1604Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0259.1 (HIF1A::ARNT)" relative to "UP00065 1 (Zfp161 primary)" |
Previous Next Top |
| Primary: UP00065 1 (Zfp161 primary) | Secondary: MA0259.1 (HIF1A::ARNT) | E-value |
|---|---|---|
|
TGGCGCGCGCGCCTGA
|
GGACGTGC
|
0.24 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3568Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||||||||||
Spacings of "MA0472.1 (EGR2)" relative to "UP00065 1 (Zfp161 primary)" |
Previous Next Top |
| Primary: UP00065 1 (Zfp161 primary) | Secondary: MA0472.1 (EGR2) | E-value |
|---|---|---|
|
TGGCGCGCGCGCCTGA
|
CCCCCGCCCACGCAC
|
0.34 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3572Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||||||
Spacings of "UP00026 1 (Zscan4 primary)" relative to "UP00065 1 (Zfp161 primary)" |
Previous Next Top |
| Primary: UP00065 1 (Zfp161 primary) | Secondary: UP00026 1 (Zscan4 primary) | E-value |
|---|---|---|
|
TGGCGCGCGCGCCTGA
|
TACATGTGCACATAAAA
|
0.76 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif975Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0150.2 (Nfe2l2)" relative to "UP00065 1 (Zfp161 primary)" |
Previous Next Top |
| Primary: UP00065 1 (Zfp161 primary) | Secondary: MA0150.2 (Nfe2l2) | E-value |
|---|---|---|
|
TGGCGCGCGCGCCTGA
|
CAGCATGACTCAGCA
|
0.98 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif615Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
| Similar Secondary: MA0501.1 (NFE2::MAF) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif298Alignment by most significant spacings
|
|||||||||||||||
Spacings of "MA0073.1 (RREB1)" relative to "UP00065 1 (Zfp161 primary)" |
Previous Next Top |
| Primary: UP00065 1 (Zfp161 primary) | Secondary: MA0073.1 (RREB1) | E-value |
|---|---|---|
|
TGGCGCGCGCGCCTGA
|
CCCCAAACCACCCCCCCCCC
|
1.5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif803Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||
Spacings of "WGCCAR (DREME)" relative to "UP00065 1 (Zfp161 primary)" |
Previous Next Top |
| Primary: UP00065 1 (Zfp161 primary) | Secondary: WGCCAR (DREME) | E-value |
|---|---|---|
|
TGGCGCGCGCGCCTGA
|
AGCCAG
|
1.6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3732Motif Databasedreme.xml |
|||||||||||
Spacings of "MA0158.1 (HOXA5)" relative to "UP00065 1 (Zfp161 primary)" |
Previous Next Top |
| Primary: UP00065 1 (Zfp161 primary) | Secondary: MA0158.1 (HOXA5) | E-value |
|---|---|---|
|
TGGCGCGCGCGCCTGA
|
CACTAATT
|
1.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1766Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00001 1 (E2F2 primary)" relative to "UP00065 1 (Zfp161 primary)" |
Previous Next Top |
| Primary: UP00065 1 (Zfp161 primary) | Secondary: UP00001 1 (E2F2 primary) | E-value |
|---|---|---|
|
TGGCGCGCGCGCCTGA
|
ATAAAGGCGCGCGAT
|
2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3126Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "TGACGTMA (DREME)" relative to "UP00065 1 (Zfp161 primary)" |
Previous Next Top |
| Primary: UP00065 1 (Zfp161 primary) | Secondary: TGACGTMA (DREME) | E-value |
|---|---|---|
|
TGGCGCGCGCGCCTGA
|
TGACGTCA
|
2.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif144Motif Databasedreme.xml |
|||||||||||
Spacings of "MA0151.1 (ARID3A)" relative to "UP00065 1 (Zfp161 primary)" |
Previous Next Top |
| Primary: UP00065 1 (Zfp161 primary) | Secondary: MA0151.1 (ARID3A) | E-value |
|---|---|---|
|
TGGCGCGCGCGCCTGA
|
ATTAAA
|
3.3 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1170Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||||||
Spacings of "MA0505.1 (Nr5a2)" relative to "UP00065 1 (Zfp161 primary)" |
Previous Next Top |
| Primary: UP00065 1 (Zfp161 primary) | Secondary: MA0505.1 (Nr5a2) | E-value |
|---|---|---|
|
TGGCGCGCGCGCCTGA
|
AAGTTCAAGGTCAGC
|
3.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1131Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0506.1 (NRF1)" relative to "UP00065 1 (Zfp161 primary)" |
Previous Next Top |
| Primary: UP00065 1 (Zfp161 primary) | Secondary: MA0506.1 (NRF1) | E-value |
|---|---|---|
|
TGGCGCGCGCGCCTGA
|
GCGCCTGCGCA
|
3.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2944Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00047 2 (Zbtb7b secondary)" relative to "UP00065 1 (Zfp161 primary)" |
Previous Next Top |
| Primary: UP00065 1 (Zfp161 primary) | Secondary: UP00047 2 (Zbtb7b secondary) | E-value |
|---|---|---|
|
TGGCGCGCGCGCCTGA
|
CTTAAGACCACCATTAC
|
4.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2179Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "ACACRB (DREME)" relative to "UP00065 1 (Zfp161 primary)" |
Previous Next Top |
| Primary: UP00065 1 (Zfp161 primary) | Secondary: ACACRB (DREME) | E-value |
|---|---|---|
|
TGGCGCGCGCGCCTGA
|
ACACAG
|
4.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3096Motif Databasedreme.xml |
|||||||||||||||||||||||
Spacings of "1 (MEME)" relative to "UP00065 1 (Zfp161 primary)" |
Previous Next Top |
| Primary: UP00065 1 (Zfp161 primary) | Secondary: 1 (MEME) | E-value |
|---|---|---|
|
TGGCGCGCGCGCCTGA
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
5.3 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4291Motif Databasememe.xml |
|||||||||||
Spacings of "UP00036 2 (Myf6 secondary)" relative to "UP00065 1 (Zfp161 primary)" |
Previous Next Top |
| Primary: UP00065 1 (Zfp161 primary) | Secondary: UP00036 2 (Myf6 secondary) | E-value |
|---|---|---|
|
TGGCGCGCGCGCCTGA
|
AGCAACAGCCGCACC
|
5.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4232Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00058 1 (Tcf3 primary)" relative to "UP00065 1 (Zfp161 primary)" |
Previous Next Top |
| Primary: UP00065 1 (Zfp161 primary) | Secondary: UP00058 1 (Tcf3 primary) | E-value |
|---|---|---|
|
TGGCGCGCGCGCCTGA
|
TATAGATCAAAGGAAAA
|
6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1444Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00045 2 (Mafb secondary)" relative to "UP00065 1 (Zfp161 primary)" |
Previous Next Top |
| Primary: UP00065 1 (Zfp161 primary) | Secondary: UP00045 2 (Mafb secondary) | E-value |
|---|---|---|
|
TGGCGCGCGCGCCTGA
|
CAATTGCAAAAATAT
|
7.6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1489Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00099 2 (Ascl2 secondary)" relative to "UP00065 1 (Zfp161 primary)" |
Previous Next Top |
| Primary: UP00065 1 (Zfp161 primary) | Secondary: UP00099 2 (Ascl2 secondary) | E-value |
|---|---|---|
|
TGGCGCGCGCGCCTGA
|
CTATCCCCGCCCTATT
|
7.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4770Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "UP00407 1 (Elf3 primary)" relative to "UP00065 1 (Zfp161 primary)" |
Previous Next Top |
| Primary: UP00065 1 (Zfp161 primary) | Secondary: UP00407 1 (Elf3 primary) | E-value |
|---|---|---|
|
TGGCGCGCGCGCCTGA
|
TACAAGGAAGTAA
|
8.5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2538Motif Databaseuniprobe mouse |
|||||||||||