The name of the primary motif.
The logo of the primary motif.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The number of secondary motifs found that had significant spacings in the tested region.
The list of secondary motifs found that had significant spacings in the tested region.
The name of the sequence database.
The last modified date of the sequence database.
The number of sequences in the sequence database.
The number of sequences in the sequence database which were excluded because they were shorter than twice the margin plus the primary motif length.
The number of sequences in the sequence database which were excluded because no match to the primary motif could be found at a distance to the edges larger than the margin.
The number of sequences in the sequence database which were excluded because they were largly identical to other sequences when aligned on the primary motif site.
The number of sequences which were scanned with the secondary motifs.
The name of the motif database derived from the file name.
The date that the motif database was last modified.
The number of motifs loaded from the motif database. Some motifs may have been excluded.
The number of motifs with significant E-values whose significant spacings were not considered too similar to those of another motif.
The number of motifs that while having significant spacings were less signficant than another motif that matched most of the same sites.
The primary motif is used as the reference point for all spacing calculation.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The secondary motif occurs at the spacings relative to the primary shown in the histogram below.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The E-value is the lowest p-value of any spacing of the secondary motif times the number of secondary motifs. It estimates the expected number of random secondary motifs that would have the observed minimum p-value or less.
The histogram below shows the frequency of spacings from the primary motif to the secondary motif. Red bars indicate that a spacing has occured a statistically significant number of times.
The details of the significant spacings are shown in the four quadrants as they relate to the quadrants of the graph.
The total number of sequences that have a match for both the primary motif and this secondary motif.
The motif database which this secondary motif came from.
The list of secondary motifs which have been identified as possibly similar to this motif because their most significant spacings overlaped with the most significant spacing of this motif. Check the boxes to show the possibly similar secondary motifs.
This shows the first secondary motif aligned with the current secondary motif by the most significant spacing.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
For further information on how to interpret these results or to get a copy of the MEME software please access http://meme.nbcr.net.
If you use SpaMo in your research please cite the following paper:
Tom Whitington, Martin C. Frith, James Johnson and Timothy L. Bailey,
"Inferring transcription factor complexes from ChIP-seq data",
Nucleic Acids Research, 39(15):e98, 2011.
[full text]
Primary Motif |
Next Top |
| Name | Preview | Significant Secondaries | List |
|---|---|---|---|
| UP00081 2 (Mybl1 secondary) |
CGACCAACTGCCGTG
|
42 | GCTGGRGA (DREME), CYGCCDCC (DREME), UP00021 1 (Zfp281 primary), UP00153 1 (Pitx1 2312.1), UP00071 1 (Sox21 primary), UP00099 2 (Ascl2 secondary), UP00077 2 (Srf secondary), UP00208 1 (Obox5 2284.1), UP00029 2 (Tbp secondary), UP00059 1 (Arid5a primary), UP00143 1 (Dobox5 3493.1), MA0486.1 (HSF1), UP00014 1 (Sox17 primary), MA0113.2 (NR3C1), UP00022 1 (Zfp740 primary), UP00029 1 (Tbp primary), UP00076 1 (Rfxdc2 primary), UP00023 2 (Sox30 secondary), UP00125 1 (Pitx2 2274.3), UP00123 1 (Hlxb9 3422.1) |
Sequence Database |
Previous Next Top |
| Name | Last Modified | Loaded | Too Short | No Primary | Too Similar | Used |
|---|---|---|---|---|---|---|
| Static Sex-independent | Wed Jun 7 10:47:08 2017 | 67058 | 0 | 52910 | 1 | 14147 |
Secondary Databases |
Previous Next Top |
| Name | Last Modified | Number of Motifs | Motifs Significant | Motifs Redundant |
|---|---|---|---|---|
| meme.xml | Wed Jun 7 10:49:30 2017 | 3 | 0 | 0 |
| dreme.xml | Wed Jun 7 15:52:22 2017 | 63 | 5 | 0 |
| JASPAR CORE 2014 vertebrates | Wed Jun 7 10:46:42 2017 | 205 | 13 | 0 |
| uniprobe mouse | Wed Jun 7 10:46:42 2017 | 385 | 24 | 6 |
Spacings of "GCTGGRGA (DREME)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: GCTGGRGA (DREME) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
GCTGGAGA
|
3.1e-07 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1019Motif Databasedreme.xml |
|||||||||||
Spacings of "CYGCCDCC (DREME)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: CYGCCDCC (DREME) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
CTGCCGCC
|
2.4e-06 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2049Motif Databasedreme.xml |
|||||||||||
Spacings of "UP00021 1 (Zfp281 primary)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: UP00021 1 (Zfp281 primary) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
TCCCCCCCCCCCCCC
|
0.00049 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5427Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "UP00153 1 (Pitx1 2312.1)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: UP00153 1 (Pitx1 2312.1) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
TTAGAGGGATTAACAAT
|
0.00066 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2480Motif Databaseuniprobe mouse |
|||||||||||
| Similar Secondary: UP00229 1 (Otx1 2325.1) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2149Alignment by most significant spacings
|
|||||||||||||||
| Similar Secondary: UP00267 1 (Otx2 3441.1) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2435Alignment by most significant spacings
|
|||||||||||||||
Spacings of "UP00071 1 (Sox21 primary)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: UP00071 1 (Sox21 primary) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
TTTAATTATAATTAAG
|
0.0051 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3570Motif Databaseuniprobe mouse |
|||||||||||
| Similar Secondary: UP00004 1 (Sox14 primary) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2941Alignment by most significant spacings
|
|||||||||||||||
Spacings of "UP00099 2 (Ascl2 secondary)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: UP00099 2 (Ascl2 secondary) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
CTATCCCCGCCCTATT
|
0.0056 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6522Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00077 2 (Srf secondary)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: UP00077 2 (Srf secondary) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
GTTAAAAAAAAAAATTT
|
0.016 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6761Motif Databaseuniprobe mouse |
|||||||||||||||||||||||||||||||||||
Spacings of "UP00208 1 (Obox5 2284.1)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: UP00208 1 (Obox5 2284.1) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
TAGAGGGATTAAATTTC
|
0.024 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1615Motif Databaseuniprobe mouse |
|||||||||||
| Similar Secondary: UP00112 1 (Gsc 2327.3) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1690Alignment by most significant spacings
|
|||||||||||||||
| Similar Secondary: UP00111 1 (Dmbx1 2277.1) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2101Alignment by most significant spacings
|
|||||||||||||||
Spacings of "UP00029 2 (Tbp secondary)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: UP00029 2 (Tbp secondary) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
CCGATTTAAGCGATC
|
0.053 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2830Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00059 1 (Arid5a primary)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: UP00059 1 (Arid5a primary) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
CTAATATTGCTAAA
|
0.062 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3200Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00143 1 (Dobox5 3493.1)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: UP00143 1 (Dobox5 3493.1) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
GGAAGGGATTAATTATC
|
0.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1781Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0486.1 (HSF1)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: MA0486.1 (HSF1) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
CTTCTAGAAGGTTCT
|
0.46 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2997Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00014 1 (Sox17 primary)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: UP00014 1 (Sox17 primary) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
ATAAACAATTAATCA
|
0.61 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4887Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0113.2 (NR3C1)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: MA0113.2 (NR3C1) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
AGAACAGAATGTTCT
|
0.63 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3311Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00022 1 (Zfp740 primary)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: UP00022 1 (Zfp740 primary) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
CCCCCCCCCCCACTTG
|
0.93 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5071Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00029 1 (Tbp primary)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: UP00029 1 (Tbp primary) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
TCTTTATATATAAATA
|
1.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3557Motif Databaseuniprobe mouse |
|||||||||||||||
Spacings of "UP00076 1 (Rfxdc2 primary)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: UP00076 1 (Rfxdc2 primary) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
CCGCATAGCAACGGA
|
1.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2446Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00023 2 (Sox30 secondary)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: UP00023 2 (Sox30 secondary) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
TAAGATTATAATACGG
|
1.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3337Motif Databaseuniprobe mouse |
|||||||||||||||
Spacings of "UP00125 1 (Pitx2 2274.3)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: UP00125 1 (Pitx2 2274.3) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
TGAAGGGATTAATCATC
|
2.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2856Motif Databaseuniprobe mouse |
|||||||||||
| Similar Secondary: UP00216 1 (Obox1 3970.2) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1573Alignment by most significant spacings
|
|||||||||||||||
Spacings of "UP00123 1 (Hlxb9 3422.1)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: UP00123 1 (Hlxb9 3422.1) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
GTACTAATTAGTGGCG
|
2.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1531Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0068.1 (Pax4)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: MA0068.1 (Pax4) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
GAAAAATTTCCCATACTCCACTCCCCCCCC
|
2.3 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5458Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0465.1 (CDX2)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: MA0465.1 (CDX2) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
AAGCCATAAAA
|
2.3 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1318Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00194 1 (Irx4 2242.3)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: UP00194 1 (Irx4 2242.3) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
AATATACATGTAAAACA
|
3.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3110Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00066 1 (Hnf4a primary)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: UP00066 1 (Hnf4a primary) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
CTTCAGGGGTCAATTGA
|
3.3 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5124Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0151.1 (ARID3A)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: MA0151.1 (ARID3A) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
ATTAAA
|
3.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5617Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00256 1 (Lhx6 2272.1)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: UP00256 1 (Lhx6 2272.1) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
GAGCGTTAATTAATGTA
|
4.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2096Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "TTTAWW (DREME)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: TTTAWW (DREME) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
TTTAAT
|
4.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5322Motif Databasedreme.xml |
|||||||||||
Spacings of "MA0491.1 (JUND)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: MA0491.1 (JUND) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
GGTGACTCATC
|
4.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1178Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||||||
Spacings of "MA0143.3 (Sox2)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: MA0143.3 (Sox2) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
CCTTTGTT
|
4.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1200Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00024 2 (Glis2 secondary)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: UP00024 2 (Glis2 secondary) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
AATATTAATAAAGA
|
4.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5205Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00249 1 (Nkx2-5 3436.1)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: UP00249 1 (Nkx2-5 3436.1) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
TAAGCCACTTGAATTT
|
5.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2673Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0472.1 (EGR2)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: MA0472.1 (EGR2) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
CCCCCGCCCACGCAC
|
6.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5321Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0131.1 (HINFP)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: MA0131.1 (HINFP) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
TAACGTCCGC
|
6.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1019Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "AAACATTW (DREME)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: AAACATTW (DREME) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
AAACATTT
|
7.3 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif456Motif Databasedreme.xml |
|||||||||||
Spacings of "MA0024.2 (E2F1)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: MA0024.2 (E2F1) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
CGGGCGGGAGG
|
7.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1247Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0009.1 (T)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: MA0009.1 (T) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
CTAGGTGTGAA
|
7.5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif450Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00047 1 (Zbtb7b primary)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: UP00047 1 (Zbtb7b primary) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
AAGCCCCCCAAAAAT
|
7.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4408Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0056.1 (MZF1 1-4)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: MA0056.1 (MZF1 1-4) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
TGGGGA
|
8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8098Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "CTGTAAYY (DREME)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: CTGTAAYY (DREME) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
CTGTAACT
|
8.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif639Motif Databasedreme.xml |
|||||||||||
Spacings of "MA0509.1 (Rfx1)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: MA0509.1 (Rfx1) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
GTTGCCATGGCAAC
|
9.3 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2524Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00033 2 (Zfp410 secondary)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: UP00033 2 (Zfp410 secondary) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
TCACCCCGCCCCTAATT
|
9.3 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7321Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00190 1 (Nkx2-3 3435.1)" relative to "UP00081 2 (Mybl1 secondary)" |
Previous Next Top |
| Primary: UP00081 2 (Mybl1 secondary) | Secondary: UP00190 1 (Nkx2-3 3435.1) | E-value |
|---|---|---|
|
CGACCAACTGCCGTG
|
CTTTAAGTACTTAATG
|
10 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2264Motif Databaseuniprobe mouse |
|||||||||||