The name of the primary motif.
The logo of the primary motif.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The number of secondary motifs found that had significant spacings in the tested region.
The list of secondary motifs found that had significant spacings in the tested region.
The name of the sequence database.
The last modified date of the sequence database.
The number of sequences in the sequence database.
The number of sequences in the sequence database which were excluded because they were shorter than twice the margin plus the primary motif length.
The number of sequences in the sequence database which were excluded because no match to the primary motif could be found at a distance to the edges larger than the margin.
The number of sequences in the sequence database which were excluded because they were largly identical to other sequences when aligned on the primary motif site.
The number of sequences which were scanned with the secondary motifs.
The name of the motif database derived from the file name.
The date that the motif database was last modified.
The number of motifs loaded from the motif database. Some motifs may have been excluded.
The number of motifs with significant E-values whose significant spacings were not considered too similar to those of another motif.
The number of motifs that while having significant spacings were less signficant than another motif that matched most of the same sites.
The primary motif is used as the reference point for all spacing calculation.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The secondary motif occurs at the spacings relative to the primary shown in the histogram below.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The E-value is the lowest p-value of any spacing of the secondary motif times the number of secondary motifs. It estimates the expected number of random secondary motifs that would have the observed minimum p-value or less.
The histogram below shows the frequency of spacings from the primary motif to the secondary motif. Red bars indicate that a spacing has occured a statistically significant number of times.
The details of the significant spacings are shown in the four quadrants as they relate to the quadrants of the graph.
The total number of sequences that have a match for both the primary motif and this secondary motif.
The motif database which this secondary motif came from.
The list of secondary motifs which have been identified as possibly similar to this motif because their most significant spacings overlaped with the most significant spacing of this motif. Check the boxes to show the possibly similar secondary motifs.
This shows the first secondary motif aligned with the current secondary motif by the most significant spacing.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
For further information on how to interpret these results or to get a copy of the MEME software please access http://meme.nbcr.net.
If you use SpaMo in your research please cite the following paper:
Tom Whitington, Martin C. Frith, James Johnson and Timothy L. Bailey,
"Inferring transcription factor complexes from ChIP-seq data",
Nucleic Acids Research, 39(15):e98, 2011.
[full text]
Primary Motif |
Next Top |
| Name | Preview | Significant Secondaries | List |
|---|---|---|---|
| MA0513.1 (SMAD2::SMAD3::SMAD4) |
CTGTCTGTCACCT
|
54 | CTGTAAYY (DREME), UP00077 2 (Srf secondary), UP00047 1 (Zbtb7b primary), UP00037 1 (Zfp105 primary), MA0041.1 (Foxd3), CCBGCCTC (DREME), UP00173 1 (Hoxc13 3127.1), MA0498.1 (Meis1), MA0060.2 (NFYA), UP00029 1 (Tbp primary), UP00005 2 (Tcfap2a secondary), UP00183 1 (Hoxa13 3126.1), UP00407 2 (Elf3 secondary), MA0146.2 (Zfx), UP00023 2 (Sox30 secondary), MA0017.1 (NR2F1), UP00021 1 (Zfp281 primary), UP00161 1 (Hmbox1 2674.1), UP00022 1 (Zfp740 primary), MA0104.3 (Mycn) |
Sequence Database |
Previous Next Top |
| Name | Last Modified | Loaded | Too Short | No Primary | Too Similar | Used |
|---|---|---|---|---|---|---|
| Static Sex-independent | Wed Jun 7 10:47:08 2017 | 67058 | 0 | 48813 | 2 | 18243 |
Secondary Databases |
Previous Next Top |
| Name | Last Modified | Number of Motifs | Motifs Significant | Motifs Redundant |
|---|---|---|---|---|
| meme.xml | Wed Jun 7 10:49:30 2017 | 3 | 2 | 0 |
| dreme.xml | Wed Jun 7 15:52:22 2017 | 63 | 4 | 0 |
| JASPAR CORE 2014 vertebrates | Wed Jun 7 10:46:42 2017 | 204 | 18 | 0 |
| uniprobe mouse | Wed Jun 7 10:46:42 2017 | 386 | 30 | 0 |
Spacings of "CTGTAAYY (DREME)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: CTGTAAYY (DREME) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
CTGTAACT
|
6.8e-08 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif796Motif Databasedreme.xml |
|||||||||||
Spacings of "UP00077 2 (Srf secondary)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: UP00077 2 (Srf secondary) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
GTTAAAAAAAAAAATTT
|
0.0017 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8357Motif Databaseuniprobe mouse |
|||||||||||||||||||||||||||||||
Spacings of "UP00047 1 (Zbtb7b primary)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: UP00047 1 (Zbtb7b primary) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
AAGCCCCCCAAAAAT
|
0.0042 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5796Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00037 1 (Zfp105 primary)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: UP00037 1 (Zfp105 primary) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
AACAAACAACAAGAG
|
0.0058 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif9003Motif Databaseuniprobe mouse |
|||||||||||||||||||||||
Spacings of "MA0041.1 (Foxd3)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: MA0041.1 (Foxd3) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
GAATGTTTGTTT
|
0.027 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5546Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||||||
Spacings of "CCBGCCTC (DREME)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: CCBGCCTC (DREME) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
CCTGCCTC
|
0.035 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1685Motif Databasedreme.xml |
|||||||||||
Spacings of "UP00173 1 (Hoxc13 3127.1)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: UP00173 1 (Hoxc13 3127.1) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
AAAGCTCGTAAAATTT
|
0.046 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2413Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0498.1 (Meis1)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: MA0498.1 (Meis1) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
AGCTGTCACTCACCT
|
0.065 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7095Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0060.2 (NFYA)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: MA0060.2 (NFYA) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
AGAGTGCTGATTGGTCCA
|
0.087 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1689Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00029 1 (Tbp primary)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: UP00029 1 (Tbp primary) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
TCTTTATATATAAATA
|
0.095 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4151Motif Databaseuniprobe mouse |
|||||||||||||||||||||||||||||||
Spacings of "UP00005 2 (Tcfap2a secondary)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: UP00005 2 (Tcfap2a secondary) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
TCACCTCTGGGCAG
|
0.095 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif10701Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00183 1 (Hoxa13 3126.1)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: UP00183 1 (Hoxa13 3126.1) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
AAACCTCGTAAAATTT
|
0.11 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1591Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00407 2 (Elf3 secondary)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: UP00407 2 (Elf3 secondary) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
GTTCAAAAAAAAAATTC
|
0.13 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7765Motif Databaseuniprobe mouse |
|||||||||||||||||||||||||||
Spacings of "MA0146.2 (Zfx)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: MA0146.2 (Zfx) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
GGGGCCGAGGCCTG
|
0.28 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6290Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00023 2 (Sox30 secondary)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: UP00023 2 (Sox30 secondary) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
TAAGATTATAATACGG
|
0.3 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4076Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0017.1 (NR2F1)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: MA0017.1 (NR2F1) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
TGACCTTTGAACCT
|
0.39 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4672Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00021 1 (Zfp281 primary)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: UP00021 1 (Zfp281 primary) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
TCCCCCCCCCCCCCC
|
0.39 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7249Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00161 1 (Hmbox1 2674.1)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: UP00161 1 (Hmbox1 2674.1) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
GAAAACTAGTTAACATC
|
0.42 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3941Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00022 1 (Zfp740 primary)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: UP00022 1 (Zfp740 primary) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
CCCCCCCCCCCACTTG
|
0.46 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6822Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0104.3 (Mycn)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: MA0104.3 (Mycn) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
GCCACGTG
|
0.48 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2868Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0512.1 (Rxra)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: MA0512.1 (Rxra) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
CAAAGGTCAGA
|
0.5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif9643Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00259 1 (Hoxb6 3428.2)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: UP00259 1 (Hoxb6 3428.2) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
TATTGGTAATTACCTT
|
0.54 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4188Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00099 1 (Ascl2 primary)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: UP00099 1 (Ascl2 primary) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
CTCAGCAGCTGCTCCTG
|
0.65 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif9330Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "UP00194 1 (Irx4 2242.3)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: UP00194 1 (Irx4 2242.3) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
AATATACATGTAAAACA
|
0.96 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3690Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0108.2 (TBP)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: MA0108.2 (TBP) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
GTATAAAAGGCGGGG
|
1.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5800Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||||||
Spacings of "UP00078 1 (Arid3a primary)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: UP00078 1 (Arid3a primary) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
GGGTTTAATTAAAATTC
|
1.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5744Motif Databaseuniprobe mouse |
|||||||||||||||||||||||||||
Spacings of "UP00028 2 (Tcfap2e secondary)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: UP00028 2 (Tcfap2e secondary) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
TACTGGAAAAAAAA
|
1.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif9201Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "MA0147.2 (Myc)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: MA0147.2 (Myc) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
CCATGTGCTT
|
1.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3029Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0111.1 (Spz1)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: MA0111.1 (Spz1) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
AGGGTAACAGC
|
1.5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6791Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0504.1 (NR2C2)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: MA0504.1 (NR2C2) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
AGGGGTCAGAGGTCA
|
2.6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5205Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00088 1 (Plagl1 primary)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: UP00088 1 (Plagl1 primary) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
TTGGGGGCGCCCCTAG
|
2.6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3792Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00100 2 (Gata6 secondary)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: UP00100 2 (Gata6 secondary) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
GCGGCGATATCGCAGCG
|
4.3 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1821Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0139.1 (CTCF)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: MA0139.1 (CTCF) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
TGGCCACCAGGGGGCGCTA
|
4.3 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3987Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00219 1 (Cutl1 3494.1)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: UP00219 1 (Cutl1 3494.1) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
ACCGGTTGATCACCTGA
|
4.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4728Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00062 1 (Sox4 primary)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: UP00062 1 (Sox4 primary) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
AGAAGAACAAAGGACTA
|
4.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6654Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00120 1 (Lbx2 3869.2)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: UP00120 1 (Lbx2 3869.2) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
TGCATTAATTAATGCGA
|
5.5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3305Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00003 1 (E2F3 primary)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: UP00003 1 (E2F3 primary) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
ATAAGGGCGCGCGAT
|
5.6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1664Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00004 1 (Sox14 primary)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: UP00004 1 (Sox14 primary) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
GCTAATTATAATTATC
|
5.9 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3388Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0598.1 (EHF)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: MA0598.1 (EHF) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
CCTTCCTG
|
6.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2823Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00061 2 (Foxl1 secondary)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: UP00061 2 (Foxl1 secondary) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
ATATCAAAACAAAACA
|
6.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8601Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "3 (MEME)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: 3 (MEME) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
TTTGTTTTTTTTTTTGTTTGTTTTTAAG
|
6.5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif894Motif Databasememe.xml |
|||||||||||
Spacings of "STGGCCA (DREME)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: STGGCCA (DREME) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
CTGGCCA
|
6.6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2565Motif Databasedreme.xml |
|||||||||||
Spacings of "UP00039 2 (Foxj3 secondary)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: UP00039 2 (Foxj3 secondary) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
AACACCAAAACAAAGGA
|
6.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8436Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00255 1 (Dbx1 3486.1)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: UP00255 1 (Dbx1 3486.1) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
TAATTAATTAATAATTA
|
6.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6263Motif Databaseuniprobe mouse |
|||||||||||||||
Spacings of "MA0497.1 (MEF2C)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: MA0497.1 (MEF2C) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
ATGCTAAAAATAGAA
|
7.6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4636Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||||||
Spacings of "AGGCDGAG (DREME)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: AGGCDGAG (DREME) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
AGGCTGAG
|
7.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2026Motif Databasedreme.xml |
|||||||||||
Spacings of "1 (MEME)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: 1 (MEME) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
7.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4113Motif Databasememe.xml |
|||||||||||
Spacings of "MA0052.2 (MEF2A)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: MA0052.2 (MEF2A) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
AGCTAAAAATAGCAT
|
8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2526Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0528.1 (ZNF263)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: MA0528.1 (ZNF263) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
GGAGGAGGAGGGGGAGGAGGA
|
8.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif9339Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00153 1 (Pitx1 2312.1)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: UP00153 1 (Pitx1 2312.1) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
TTAGAGGGATTAACAAT
|
8.6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3161Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0161.1 (NFIC)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: MA0161.1 (NFIC) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
TTGGCA
|
8.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif16152Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0091.1 (TAL1::TCF3)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: MA0091.1 (TAL1::TCF3) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
CGACCATCTGTT
|
9.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3480Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00213 1 (Hoxa9 2622.2)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: UP00213 1 (Hoxa9 2622.2) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
ACGGCCATAAAATTAAT
|
9.6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4582Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00164 1 (Hoxa7 2668.2)" relative to "MA0513.1 (SMAD2::SMAD3::SMAD4)" |
Previous Next Top |
| Primary: MA0513.1 (SMAD2::SMAD3::SMAD4) | Secondary: UP00164 1 (Hoxa7 2668.2) | E-value |
|---|---|---|
|
CTGTCTGTCACCT
|
CGAGTTAATTAATAAGC
|
9.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4711Motif Databaseuniprobe mouse |
|||||||||||