The name of the primary motif.
The logo of the primary motif.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The number of secondary motifs found that had significant spacings in the tested region.
The list of secondary motifs found that had significant spacings in the tested region.
The name of the sequence database.
The last modified date of the sequence database.
The number of sequences in the sequence database.
The number of sequences in the sequence database which were excluded because they were shorter than twice the margin plus the primary motif length.
The number of sequences in the sequence database which were excluded because no match to the primary motif could be found at a distance to the edges larger than the margin.
The number of sequences in the sequence database which were excluded because they were largly identical to other sequences when aligned on the primary motif site.
The number of sequences which were scanned with the secondary motifs.
The name of the motif database derived from the file name.
The date that the motif database was last modified.
The number of motifs loaded from the motif database. Some motifs may have been excluded.
The number of motifs with significant E-values whose significant spacings were not considered too similar to those of another motif.
The number of motifs that while having significant spacings were less signficant than another motif that matched most of the same sites.
The primary motif is used as the reference point for all spacing calculation.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The secondary motif occurs at the spacings relative to the primary shown in the histogram below.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The E-value is the lowest p-value of any spacing of the secondary motif times the number of secondary motifs. It estimates the expected number of random secondary motifs that would have the observed minimum p-value or less.
The histogram below shows the frequency of spacings from the primary motif to the secondary motif. Red bars indicate that a spacing has occured a statistically significant number of times.
The details of the significant spacings are shown in the four quadrants as they relate to the quadrants of the graph.
The total number of sequences that have a match for both the primary motif and this secondary motif.
The motif database which this secondary motif came from.
The list of secondary motifs which have been identified as possibly similar to this motif because their most significant spacings overlaped with the most significant spacing of this motif. Check the boxes to show the possibly similar secondary motifs.
This shows the first secondary motif aligned with the current secondary motif by the most significant spacing.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
For further information on how to interpret these results or to get a copy of the MEME software please access http://meme.nbcr.net.
If you use SpaMo in your research please cite the following paper:
Tom Whitington, Martin C. Frith, James Johnson and Timothy L. Bailey,
"Inferring transcription factor complexes from ChIP-seq data",
Nucleic Acids Research, 39(15):e98, 2011.
[full text]
Primary Motif |
Next Top |
| Name | Preview | Significant Secondaries | List |
|---|---|---|---|
| MA0510.1 (RFX5) |
CTCCCTGGCAACAGC
|
35 | MA0017.1 (NR2F1), CTGAGYCA (DREME), UP00071 1 (Sox21 primary), UP00066 1 (Hnf4a primary), MA0133.1 (BRCA1), UP00077 2 (Srf secondary), MA0139.1 (CTCF), UP00407 2 (Elf3 secondary), UP00095 1 (Zfp691 primary), UP00078 1 (Arid3a primary), UP00089 3 (Tcf1 2666.2), UP00061 2 (Foxl1 secondary), UP00242 1 (Hoxc8 3429.2), UP00103 2 (Jundm2 secondary), MA0091.1 (TAL1::TCF3), UP00069 1 (Sox1 primary), GCTGGRGA (DREME), UP00046 2 (Tcfe2a secondary), MA0099.2 (JUN::FOS), MA0528.1 (ZNF263) |
Sequence Database |
Previous Next Top |
| Name | Last Modified | Loaded | Too Short | No Primary | Too Similar | Used |
|---|---|---|---|---|---|---|
| Static Sex-independent | Wed Jun 7 10:47:08 2017 | 67058 | 0 | 50848 | 4 | 16206 |
Secondary Databases |
Previous Next Top |
| Name | Last Modified | Number of Motifs | Motifs Significant | Motifs Redundant |
|---|---|---|---|---|
| meme.xml | Wed Jun 7 10:49:30 2017 | 3 | 0 | 0 |
| dreme.xml | Wed Jun 7 15:52:22 2017 | 63 | 4 | 1 |
| JASPAR CORE 2014 vertebrates | Wed Jun 7 10:46:42 2017 | 204 | 9 | 3 |
| uniprobe mouse | Wed Jun 7 10:46:42 2017 | 386 | 22 | 4 |
Spacings of "MA0017.1 (NR2F1)" relative to "MA0510.1 (RFX5)" |
Previous Next Top |
| Primary: MA0510.1 (RFX5) | Secondary: MA0017.1 (NR2F1) | E-value |
|---|---|---|
|
CTCCCTGGCAACAGC
|
TGACCTTTGAACCT
|
2.5e-09 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4050Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
| Similar Secondary: MA0512.1 (Rxra) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8371Alignment by most significant spacings
|
|||||||||||||||
| Similar Secondary: RAGKTCA (DREME) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4401Alignment by most significant spacings
|
|||||||||||||||
Spacings of "CTGAGYCA (DREME)" relative to "MA0510.1 (RFX5)" |
Previous Next Top |
| Primary: MA0510.1 (RFX5) | Secondary: CTGAGYCA (DREME) | E-value |
|---|---|---|
|
CTCCCTGGCAACAGC
|
CTGAGTCA
|
1.4e-08 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1119Motif Databasedreme.xml |
|||||||||||
| Similar Secondary: MA0478.1 (FOSL2) | |||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2416Alignment by most significant spacings
|
|||||||||||||||||||||||
Spacings of "UP00071 1 (Sox21 primary)" relative to "MA0510.1 (RFX5)" |
Previous Next Top |
| Primary: MA0510.1 (RFX5) | Secondary: UP00071 1 (Sox21 primary) | E-value |
|---|---|---|
|
CTCCCTGGCAACAGC
|
TTTAATTATAATTAAG
|
2.5e-05 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3675Motif Databaseuniprobe mouse |
|||||||||||||||||||
| Similar Secondary: UP00004 1 (Sox14 primary) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2979Alignment by most significant spacings
|
|||||||||||||||
Spacings of "UP00066 1 (Hnf4a primary)" relative to "MA0510.1 (RFX5)" |
Previous Next Top |
| Primary: MA0510.1 (RFX5) | Secondary: UP00066 1 (Hnf4a primary) | E-value |
|---|---|---|
|
CTCCCTGGCAACAGC
|
CTTCAGGGGTCAATTGA
|
3.6e-05 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5859Motif Databaseuniprobe mouse |
|||||||||||
| Similar Secondary: UP00053 1 (Rxra primary) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6741Alignment by most significant spacings
|
|||||||||||||||
Spacings of "MA0133.1 (BRCA1)" relative to "MA0510.1 (RFX5)" |
Previous Next Top |
| Primary: MA0510.1 (RFX5) | Secondary: MA0133.1 (BRCA1) | E-value |
|---|---|---|
|
CTCCCTGGCAACAGC
|
ACAACAC
|
4.7e-05 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7522Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00077 2 (Srf secondary)" relative to "MA0510.1 (RFX5)" |
Previous Next Top |
| Primary: MA0510.1 (RFX5) | Secondary: UP00077 2 (Srf secondary) | E-value |
|---|---|---|
|
CTCCCTGGCAACAGC
|
GTTAAAAAAAAAAATTT
|
0.00022 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7157Motif Databaseuniprobe mouse |
|||||||||||||||||||||||||||
Spacings of "MA0139.1 (CTCF)" relative to "MA0510.1 (RFX5)" |
Previous Next Top |
| Primary: MA0510.1 (RFX5) | Secondary: MA0139.1 (CTCF) | E-value |
|---|---|---|
|
CTCCCTGGCAACAGC
|
TGGCCACCAGGGGGCGCTA
|
0.0037 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3800Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||||||||||||||
Spacings of "UP00407 2 (Elf3 secondary)" relative to "MA0510.1 (RFX5)" |
Previous Next Top |
| Primary: MA0510.1 (RFX5) | Secondary: UP00407 2 (Elf3 secondary) | E-value |
|---|---|---|
|
CTCCCTGGCAACAGC
|
GTTCAAAAAAAAAATTC
|
0.014 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6758Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "UP00095 1 (Zfp691 primary)" relative to "MA0510.1 (RFX5)" |
Previous Next Top |
| Primary: MA0510.1 (RFX5) | Secondary: UP00095 1 (Zfp691 primary) | E-value |
|---|---|---|
|
CTCCCTGGCAACAGC
|
CGAACAGTGCTCACTAT
|
0.033 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3943Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "UP00078 1 (Arid3a primary)" relative to "MA0510.1 (RFX5)" |
Previous Next Top |
| Primary: MA0510.1 (RFX5) | Secondary: UP00078 1 (Arid3a primary) | E-value |
|---|---|---|
|
CTCCCTGGCAACAGC
|
GGGTTTAATTAAAATTC
|
0.051 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4883Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00089 3 (Tcf1 2666.2)" relative to "MA0510.1 (RFX5)" |
Previous Next Top |
| Primary: MA0510.1 (RFX5) | Secondary: UP00089 3 (Tcf1 2666.2) | E-value |
|---|---|---|
|
CTCCCTGGCAACAGC
|
CCTTAGTTAACTAAAAT
|
0.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3275Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00061 2 (Foxl1 secondary)" relative to "MA0510.1 (RFX5)" |
Previous Next Top |
| Primary: MA0510.1 (RFX5) | Secondary: UP00061 2 (Foxl1 secondary) | E-value |
|---|---|---|
|
CTCCCTGGCAACAGC
|
ATATCAAAACAAAACA
|
0.13 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7486Motif Databaseuniprobe mouse |
|||||||||||||||
Spacings of "UP00242 1 (Hoxc8 3429.2)" relative to "MA0510.1 (RFX5)" |
Previous Next Top |
| Primary: MA0510.1 (RFX5) | Secondary: UP00242 1 (Hoxc8 3429.2) | E-value |
|---|---|---|
|
CTCCCTGGCAACAGC
|
TTGGGGTAATTAACGT
|
0.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2895Motif Databaseuniprobe mouse |
|||||||||||
| Similar Secondary: UP00202 1 (Dlx1 1741.2) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1927Alignment by most significant spacings
|
|||||||||||||||
| Similar Secondary: UP00206 1 (Hoxb7 3953.1) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2424Alignment by most significant spacings
|
|||||||||||||||
Spacings of "UP00103 2 (Jundm2 secondary)" relative to "MA0510.1 (RFX5)" |
Previous Next Top |
| Primary: MA0510.1 (RFX5) | Secondary: UP00103 2 (Jundm2 secondary) | E-value |
|---|---|---|
|
CTCCCTGGCAACAGC
|
ATTGATGAGTCACCAA
|
0.27 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2681Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0091.1 (TAL1::TCF3)" relative to "MA0510.1 (RFX5)" |
Previous Next Top |
| Primary: MA0510.1 (RFX5) | Secondary: MA0091.1 (TAL1::TCF3) | E-value |
|---|---|---|
|
CTCCCTGGCAACAGC
|
CGACCATCTGTT
|
0.62 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3140Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00069 1 (Sox1 primary)" relative to "MA0510.1 (RFX5)" |
Previous Next Top |
| Primary: MA0510.1 (RFX5) | Secondary: UP00069 1 (Sox1 primary) | E-value |
|---|---|---|
|
CTCCCTGGCAACAGC
|
AATCAATTCAATAATT
|
0.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5671Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "GCTGGRGA (DREME)" relative to "MA0510.1 (RFX5)" |
Previous Next Top |
| Primary: MA0510.1 (RFX5) | Secondary: GCTGGRGA (DREME) | E-value |
|---|---|---|
|
CTCCCTGGCAACAGC
|
GCTGGAGA
|
0.97 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1223Motif Databasedreme.xml |
|||||||||||
Spacings of "UP00046 2 (Tcfe2a secondary)" relative to "MA0510.1 (RFX5)" |
Previous Next Top |
| Primary: MA0510.1 (RFX5) | Secondary: UP00046 2 (Tcfe2a secondary) | E-value |
|---|---|---|
|
CTCCCTGGCAACAGC
|
AAGGCCAGATGGTCCGG
|
1.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8590Motif Databaseuniprobe mouse |
|||||||||||
| Similar Secondary: MA0461.1 (Atoh1) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3125Alignment by most significant spacings
|
|||||||||||||||
Spacings of "MA0099.2 (JUN::FOS)" relative to "MA0510.1 (RFX5)" |
Previous Next Top |
| Primary: MA0510.1 (RFX5) | Secondary: MA0099.2 (JUN::FOS) | E-value |
|---|---|---|
|
CTCCCTGGCAACAGC
|
TGACTCA
|
1.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8447Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0528.1 (ZNF263)" relative to "MA0510.1 (RFX5)" |
Previous Next Top |
| Primary: MA0510.1 (RFX5) | Secondary: MA0528.1 (ZNF263) | E-value |
|---|---|---|
|
CTCCCTGGCAACAGC
|
GGAGGAGGAGGGGGAGGAGGA
|
1.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8340Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00041 2 (Foxj1 secondary)" relative to "MA0510.1 (RFX5)" |
Previous Next Top |
| Primary: MA0510.1 (RFX5) | Secondary: UP00041 2 (Foxj1 secondary) | E-value |
|---|---|---|
|
CTCCCTGGCAACAGC
|
ATGTCACAACAACAC
|
1.9 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7015Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "WGCCAR (DREME)" relative to "MA0510.1 (RFX5)" |
Previous Next Top |
| Primary: MA0510.1 (RFX5) | Secondary: WGCCAR (DREME) | E-value |
|---|---|---|
|
CTCCCTGGCAACAGC
|
AGCCAG
|
2.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif12068Motif Databasedreme.xml |
|||||||||||
Spacings of "UP00024 2 (Glis2 secondary)" relative to "MA0510.1 (RFX5)" |
Previous Next Top |
| Primary: MA0510.1 (RFX5) | Secondary: UP00024 2 (Glis2 secondary) | E-value |
|---|---|---|
|
CTCCCTGGCAACAGC
|
AATATTAATAAAGA
|
2.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5359Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "CYGCCDCC (DREME)" relative to "MA0510.1 (RFX5)" |
Previous Next Top |
| Primary: MA0510.1 (RFX5) | Secondary: CYGCCDCC (DREME) | E-value |
|---|---|---|
|
CTCCCTGGCAACAGC
|
CTGCCGCC
|
2.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2652Motif Databasedreme.xml |
|||||||||||
Spacings of "UP00002 1 (Sp4 primary)" relative to "MA0510.1 (RFX5)" |
Previous Next Top |
| Primary: MA0510.1 (RFX5) | Secondary: UP00002 1 (Sp4 primary) | E-value |
|---|---|---|
|
CTCCCTGGCAACAGC
|
GGTCCCGCCCCCTTCTC
|
3.5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5437Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00044 1 (Mafk primary)" relative to "MA0510.1 (RFX5)" |
Previous Next Top |
| Primary: MA0510.1 (RFX5) | Secondary: UP00044 1 (Mafk primary) | E-value |
|---|---|---|
|
CTCCCTGGCAACAGC
|
TAAAAATGCTGACTT
|
5.6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4831Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00021 1 (Zfp281 primary)" relative to "MA0510.1 (RFX5)" |
Previous Next Top |
| Primary: MA0510.1 (RFX5) | Secondary: UP00021 1 (Zfp281 primary) | E-value |
|---|---|---|
|
CTCCCTGGCAACAGC
|
TCCCCCCCCCCCCCC
|
5.6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6495Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00187 1 (Alx4 1744.1)" relative to "MA0510.1 (RFX5)" |
Previous Next Top |
| Primary: MA0510.1 (RFX5) | Secondary: UP00187 1 (Alx4 1744.1) | E-value |
|---|---|---|
|
CTCCCTGGCAACAGC
|
CGCATTAATTAATTACC
|
6.3 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1441Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00217 1 (Hoxa10 2318.1)" relative to "MA0510.1 (RFX5)" |
Previous Next Top |
| Primary: MA0510.1 (RFX5) | Secondary: UP00217 1 (Hoxa10 2318.1) | E-value |
|---|---|---|
|
CTCCCTGGCAACAGC
|
TAGGTAATAAAATTCA
|
6.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4568Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00037 1 (Zfp105 primary)" relative to "MA0510.1 (RFX5)" |
Previous Next Top |
| Primary: MA0510.1 (RFX5) | Secondary: UP00037 1 (Zfp105 primary) | E-value |
|---|---|---|
|
CTCCCTGGCAACAGC
|
AACAAACAACAAGAG
|
7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7777Motif Databaseuniprobe mouse |
|||||||||||||||
Spacings of "UP00050 1 (Bhlhb2 primary)" relative to "MA0510.1 (RFX5)" |
Previous Next Top |
| Primary: MA0510.1 (RFX5) | Secondary: UP00050 1 (Bhlhb2 primary) | E-value |
|---|---|---|
|
CTCCCTGGCAACAGC
|
GGAAGAGTCACGTGACCAATAC
|
7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2265Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0033.1 (FOXL1)" relative to "MA0510.1 (RFX5)" |
Previous Next Top |
| Primary: MA0510.1 (RFX5) | Secondary: MA0033.1 (FOXL1) | E-value |
|---|---|---|
|
CTCCCTGGCAACAGC
|
TATACATA
|
7.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6117Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0018.2 (CREB1)" relative to "MA0510.1 (RFX5)" |
Previous Next Top |
| Primary: MA0510.1 (RFX5) | Secondary: MA0018.2 (CREB1) | E-value |
|---|---|---|
|
CTCCCTGGCAACAGC
|
TGACGTCA
|
8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5796Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0069.1 (Pax6)" relative to "MA0510.1 (RFX5)" |
Previous Next Top |
| Primary: MA0510.1 (RFX5) | Secondary: MA0069.1 (Pax6) | E-value |
|---|---|---|
|
CTCCCTGGCAACAGC
|
TTCACGCATGAGTT
|
8.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2230Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00255 1 (Dbx1 3486.1)" relative to "MA0510.1 (RFX5)" |
Previous Next Top |
| Primary: MA0510.1 (RFX5) | Secondary: UP00255 1 (Dbx1 3486.1) | E-value |
|---|---|---|
|
CTCCCTGGCAACAGC
|
TAATTAATTAATAATTA
|
9.3 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5360Motif Databaseuniprobe mouse |
|||||||||||