The name of the primary motif.
The logo of the primary motif.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The number of secondary motifs found that had significant spacings in the tested region.
The list of secondary motifs found that had significant spacings in the tested region.
The name of the sequence database.
The last modified date of the sequence database.
The number of sequences in the sequence database.
The number of sequences in the sequence database which were excluded because they were shorter than twice the margin plus the primary motif length.
The number of sequences in the sequence database which were excluded because no match to the primary motif could be found at a distance to the edges larger than the margin.
The number of sequences in the sequence database which were excluded because they were largly identical to other sequences when aligned on the primary motif site.
The number of sequences which were scanned with the secondary motifs.
The name of the motif database derived from the file name.
The date that the motif database was last modified.
The number of motifs loaded from the motif database. Some motifs may have been excluded.
The number of motifs with significant E-values whose significant spacings were not considered too similar to those of another motif.
The number of motifs that while having significant spacings were less signficant than another motif that matched most of the same sites.
The primary motif is used as the reference point for all spacing calculation.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The secondary motif occurs at the spacings relative to the primary shown in the histogram below.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The E-value is the lowest p-value of any spacing of the secondary motif times the number of secondary motifs. It estimates the expected number of random secondary motifs that would have the observed minimum p-value or less.
The histogram below shows the frequency of spacings from the primary motif to the secondary motif. Red bars indicate that a spacing has occured a statistically significant number of times.
The details of the significant spacings are shown in the four quadrants as they relate to the quadrants of the graph.
The total number of sequences that have a match for both the primary motif and this secondary motif.
The motif database which this secondary motif came from.
The list of secondary motifs which have been identified as possibly similar to this motif because their most significant spacings overlaped with the most significant spacing of this motif. Check the boxes to show the possibly similar secondary motifs.
This shows the first secondary motif aligned with the current secondary motif by the most significant spacing.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
For further information on how to interpret these results or to get a copy of the MEME software please access http://meme.nbcr.net.
If you use SpaMo in your research please cite the following paper:
Tom Whitington, Martin C. Frith, James Johnson and Timothy L. Bailey,
"Inferring transcription factor complexes from ChIP-seq data",
Nucleic Acids Research, 39(15):e98, 2011.
[full text]
Primary Motif |
Next Top |
| Name | Preview | Significant Secondaries | List |
|---|---|---|---|
| UP00010 2 (Tcfap2b secondary) |
ATTGCCTCAGGCAAT
|
41 | MA0161.1 (NFIC), UP00021 1 (Zfp281 primary), UP00071 1 (Sox21 primary), 1 (MEME), UP00164 1 (Hoxa7 2668.2), UP00033 2 (Zfp410 secondary), UP00087 2 (Tcfap2c secondary), UP00077 2 (Srf secondary), MA0056.1 (MZF1 1-4), MA0481.1 (FOXP1), CYCCDCCC (DREME), UP00022 1 (Zfp740 primary), UP00225 1 (Hlx1 2350.1), MA0528.1 (ZNF263), UP00099 1 (Ascl2 primary), UP00094 2 (Zfp128 secondary), UP00059 1 (Arid5a primary), UP00209 2 (Cart1 1275.1), UP00206 1 (Hoxb7 3953.1), MA0038.1 (Gfi1) |
Sequence Database |
Previous Next Top |
| Name | Last Modified | Loaded | Too Short | No Primary | Too Similar | Used |
|---|---|---|---|---|---|---|
| Static Sex-independent | Wed Jun 7 10:47:08 2017 | 67058 | 0 | 46915 | 2 | 20141 |
Secondary Databases |
Previous Next Top |
| Name | Last Modified | Number of Motifs | Motifs Significant | Motifs Redundant |
|---|---|---|---|---|
| meme.xml | Wed Jun 7 10:49:30 2017 | 3 | 1 | 0 |
| dreme.xml | Wed Jun 7 15:52:22 2017 | 63 | 6 | 0 |
| JASPAR CORE 2014 vertebrates | Wed Jun 7 10:46:42 2017 | 205 | 10 | 0 |
| uniprobe mouse | Wed Jun 7 10:46:42 2017 | 385 | 24 | 1 |
Spacings of "MA0161.1 (NFIC)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: MA0161.1 (NFIC) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
TTGGCA
|
1.3e-07 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif17707Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||
Spacings of "UP00021 1 (Zfp281 primary)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: UP00021 1 (Zfp281 primary) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
TCCCCCCCCCCCCCC
|
1.8e-05 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif9016Motif Databaseuniprobe mouse |
|||||||||||||||||||||||||||
Spacings of "UP00071 1 (Sox21 primary)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: UP00071 1 (Sox21 primary) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
TTTAATTATAATTAAG
|
0.00075 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3744Motif Databaseuniprobe mouse |
|||||||||||||||||||
| Similar Secondary: UP00004 1 (Sox14 primary) | |||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3055Alignment by most significant spacings
|
|||||||||||||||||||||||
Spacings of "1 (MEME)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: 1 (MEME) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
0.0011 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7098Motif Databasememe.xml |
|||||||||||||||
Spacings of "UP00164 1 (Hoxa7 2668.2)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: UP00164 1 (Hoxa7 2668.2) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
CGAGTTAATTAATAAGC
|
0.0011 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4262Motif Databaseuniprobe mouse |
|||||||||||||||
Spacings of "UP00033 2 (Zfp410 secondary)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: UP00033 2 (Zfp410 secondary) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
TCACCCCGCCCCTAATT
|
0.0017 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif12559Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00087 2 (Tcfap2c secondary)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: UP00087 2 (Tcfap2c secondary) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
CCGCCCAAGGGCAG
|
0.0058 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif10614Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00077 2 (Srf secondary)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: UP00077 2 (Srf secondary) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
GTTAAAAAAAAAAATTT
|
0.02 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7809Motif Databaseuniprobe mouse |
|||||||||||||||||||||||||||||||||||||||||||
Spacings of "MA0056.1 (MZF1 1-4)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: MA0056.1 (MZF1 1-4) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
TGGGGA
|
0.029 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif12410Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0481.1 (FOXP1)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: MA0481.1 (FOXP1) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
CAAAAGTAAACAAAG
|
0.36 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6005Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||||||||||
Spacings of "CYCCDCCC (DREME)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: CYCCDCCC (DREME) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
CCCCTCCC
|
0.54 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6584Motif Databasedreme.xml |
|||||||||||
Spacings of "UP00022 1 (Zfp740 primary)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: UP00022 1 (Zfp740 primary) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
CCCCCCCCCCCACTTG
|
0.77 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8034Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "UP00225 1 (Hlx1 2350.1)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: UP00225 1 (Hlx1 2350.1) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
CCATAATTAATTACA
|
0.81 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3774Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0528.1 (ZNF263)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: MA0528.1 (ZNF263) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
GGAGGAGGAGGGGGAGGAGGA
|
1.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif10524Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00099 1 (Ascl2 primary)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: UP00099 1 (Ascl2 primary) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
CTCAGCAGCTGCTCCTG
|
1.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif10313Motif Databaseuniprobe mouse |
|||||||||||||||||||||||
Spacings of "UP00094 2 (Zfp128 secondary)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: UP00094 2 (Zfp128 secondary) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
TGTATATATATACC
|
2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3669Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00059 1 (Arid5a primary)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: UP00059 1 (Arid5a primary) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
CTAATATTGCTAAA
|
2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3377Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00209 2 (Cart1 1275.1)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: UP00209 2 (Cart1 1275.1) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
CGCATTAATTAATTGGC
|
2.3 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1565Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00206 1 (Hoxb7 3953.1)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: UP00206 1 (Hoxb7 3953.1) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
GTAGTAATTAATGCAA
|
2.5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2581Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0038.1 (Gfi1)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: MA0038.1 (Gfi1) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
CAAATCACTG
|
2.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8901Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||
Spacings of "UP00255 1 (Dbx1 3486.1)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: UP00255 1 (Dbx1 3486.1) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
TAATTAATTAATAATTA
|
2.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5624Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "ARAGGGCA (DREME)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: ARAGGGCA (DREME) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
AGAGGGCA
|
3 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1145Motif Databasedreme.xml |
|||||||||||
Spacings of "MA0052.2 (MEF2A)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: MA0052.2 (MEF2A) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
AGCTAAAAATAGCAT
|
3.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2331Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00028 2 (Tcfap2e secondary)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: UP00028 2 (Tcfap2e secondary) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
TACTGGAAAAAAAA
|
3.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8900Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00407 2 (Elf3 secondary)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: UP00407 2 (Elf3 secondary) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
GTTCAAAAAAAAAATTC
|
3.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7219Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "UP00262 1 (Lhx1 2240.2)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: UP00262 1 (Lhx1 2240.2) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
CGAATTAATTAATAATG
|
3.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2085Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0068.1 (Pax4)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: MA0068.1 (Pax4) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
GAAAAATTTCCCATACTCCACTCCCCCCCC
|
3.5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6490Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00153 1 (Pitx1 2312.1)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: UP00153 1 (Pitx1 2312.1) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
TTAGAGGGATTAACAAT
|
3.6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2952Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "GCDGCMGC (DREME)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: GCDGCMGC (DREME) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
GCAGCAGC
|
3.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3003Motif Databasedreme.xml |
|||||||||||
Spacings of "UP00144 1 (Hoxb4 2627.1)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: UP00144 1 (Hoxb4 2627.1) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
CGCGTTAATTAATTACC
|
4.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2341Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "AGRDGGCG (DREME)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: AGRDGGCG (DREME) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
AGGGGGCG
|
5.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2498Motif Databasedreme.xml |
|||||||||||
Spacings of "UP00169 1 (Lmx1b 3433.2)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: UP00169 1 (Lmx1b 3433.2) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
AGTTTTTAATTAATTTG
|
5.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1935Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00088 1 (Plagl1 primary)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: UP00088 1 (Plagl1 primary) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
TTGGGGGCGCCCCTAG
|
6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5658Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0141.2 (Esrrb)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: MA0141.2 (Esrrb) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
AGCTCAAGGTCA
|
6.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7776Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "AAATAY (DREME)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: AAATAY (DREME) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
AAATAC
|
7.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3204Motif Databasedreme.xml |
|||||||||||
Spacings of "STGGCCA (DREME)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: STGGCCA (DREME) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
CTGGCCA
|
7.9 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2606Motif Databasedreme.xml |
|||||||||||
Spacings of "UP00244 1 (Tlx2 3498.2)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: UP00244 1 (Tlx2 3498.2) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
TAATTAATTAATAACTT
|
8.3 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4223Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "UP00100 2 (Gata6 secondary)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: UP00100 2 (Gata6 secondary) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
GCGGCGATATCGCAGCG
|
8.9 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2759Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0102.3 (CEBPA)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: MA0102.3 (CEBPA) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
ATTGCACAATA
|
9.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4122Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00213 1 (Hoxa9 2622.2)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: UP00213 1 (Hoxa9 2622.2) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
ACGGCCATAAAATTAAT
|
9.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4269Motif Databaseuniprobe mouse |
|||||||||||||||||||||||||||
Spacings of "MA0041.1 (Foxd3)" relative to "UP00010 2 (Tcfap2b secondary)" |
Previous Next Top |
| Primary: UP00010 2 (Tcfap2b secondary) | Secondary: MA0041.1 (Foxd3) | E-value |
|---|---|---|
|
ATTGCCTCAGGCAAT
|
GAATGTTTGTTT
|
9.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5044Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||