The name of the primary motif.
The logo of the primary motif.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The number of secondary motifs found that had significant spacings in the tested region.
The list of secondary motifs found that had significant spacings in the tested region.
The name of the sequence database.
The last modified date of the sequence database.
The number of sequences in the sequence database.
The number of sequences in the sequence database which were excluded because they were shorter than twice the margin plus the primary motif length.
The number of sequences in the sequence database which were excluded because no match to the primary motif could be found at a distance to the edges larger than the margin.
The number of sequences in the sequence database which were excluded because they were largly identical to other sequences when aligned on the primary motif site.
The number of sequences which were scanned with the secondary motifs.
The name of the motif database derived from the file name.
The date that the motif database was last modified.
The number of motifs loaded from the motif database. Some motifs may have been excluded.
The number of motifs with significant E-values whose significant spacings were not considered too similar to those of another motif.
The number of motifs that while having significant spacings were less signficant than another motif that matched most of the same sites.
The primary motif is used as the reference point for all spacing calculation.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The secondary motif occurs at the spacings relative to the primary shown in the histogram below.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The E-value is the lowest p-value of any spacing of the secondary motif times the number of secondary motifs. It estimates the expected number of random secondary motifs that would have the observed minimum p-value or less.
The histogram below shows the frequency of spacings from the primary motif to the secondary motif. Red bars indicate that a spacing has occured a statistically significant number of times.
The details of the significant spacings are shown in the four quadrants as they relate to the quadrants of the graph.
The total number of sequences that have a match for both the primary motif and this secondary motif.
The motif database which this secondary motif came from.
The list of secondary motifs which have been identified as possibly similar to this motif because their most significant spacings overlaped with the most significant spacing of this motif. Check the boxes to show the possibly similar secondary motifs.
This shows the first secondary motif aligned with the current secondary motif by the most significant spacing.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
For further information on how to interpret these results or to get a copy of the MEME software please access http://meme.nbcr.net.
If you use SpaMo in your research please cite the following paper:
Tom Whitington, Martin C. Frith, James Johnson and Timothy L. Bailey,
"Inferring transcription factor complexes from ChIP-seq data",
Nucleic Acids Research, 39(15):e98, 2011.
[full text]
Primary Motif |
Next Top |
| Name | Preview | Significant Secondaries | List |
|---|---|---|---|
| MA0014.2 (PAX5) |
GAGGGCAGCCAAGCGTGAC
|
27 | AGGCDGAG (DREME), 1 (MEME), RAGKTCA (DREME), 3 (MEME), UP00164 1 (Hoxa7 2668.2), UP00037 1 (Zfp105 primary), MA0087.1 (Sox5), MA0505.1 (Nr5a2), UP00035 2 (Hic1 secondary), MA0599.1 (KLF5), MA0516.1 (SP2), UP00172 1 (Prop1 3949.1), UP00079 2 (Esrra secondary), MA0161.1 (NFIC), GCTGGRGA (DREME), UP00053 1 (Rxra primary), MA0528.1 (ZNF263), UP00096 1 (Sox13 primary), MA0052.2 (MEF2A), UP00015 1 (Ehf primary) |
Sequence Database |
Previous Next Top |
| Name | Last Modified | Loaded | Too Short | No Primary | Too Similar | Used |
|---|---|---|---|---|---|---|
| Static Sex-independent | Wed Jun 7 10:47:08 2017 | 67058 | 0 | 54091 | 2 | 12965 |
Secondary Databases |
Previous Next Top |
| Name | Last Modified | Number of Motifs | Motifs Significant | Motifs Redundant |
|---|---|---|---|---|
| meme.xml | Wed Jun 7 10:49:30 2017 | 3 | 2 | 0 |
| dreme.xml | Wed Jun 7 15:52:22 2017 | 63 | 3 | 0 |
| JASPAR CORE 2014 vertebrates | Wed Jun 7 10:46:42 2017 | 204 | 9 | 0 |
| uniprobe mouse | Wed Jun 7 10:46:42 2017 | 386 | 13 | 1 |
Spacings of "AGGCDGAG (DREME)" relative to "MA0014.2 (PAX5)" |
Previous Next Top |
| Primary: MA0014.2 (PAX5) | Secondary: AGGCDGAG (DREME) | E-value |
|---|---|---|
|
GAGGGCAGCCAAGCGTGAC
|
AGGCTGAG
|
0.0009 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1480Motif Databasedreme.xml |
|||||||||||
Spacings of "1 (MEME)" relative to "MA0014.2 (PAX5)" |
Previous Next Top |
| Primary: MA0014.2 (PAX5) | Secondary: 1 (MEME) | E-value |
|---|---|---|
|
GAGGGCAGCCAAGCGTGAC
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
0.0082 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4136Motif Databasememe.xml |
|||||||||||
Spacings of "RAGKTCA (DREME)" relative to "MA0014.2 (PAX5)" |
Previous Next Top |
| Primary: MA0014.2 (PAX5) | Secondary: RAGKTCA (DREME) | E-value |
|---|---|---|
|
GAGGGCAGCCAAGCGTGAC
|
AAGGTCA
|
0.15 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3186Motif Databasedreme.xml |
|||||||||||
Spacings of "3 (MEME)" relative to "MA0014.2 (PAX5)" |
Previous Next Top |
| Primary: MA0014.2 (PAX5) | Secondary: 3 (MEME) | E-value |
|---|---|---|
|
GAGGGCAGCCAAGCGTGAC
|
TTTGTTTTTTTTTTTGTTTGTTTTTAAG
|
0.3 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif628Motif Databasememe.xml |
|||||||||||||||||||
Spacings of "UP00164 1 (Hoxa7 2668.2)" relative to "MA0014.2 (PAX5)" |
Previous Next Top |
| Primary: MA0014.2 (PAX5) | Secondary: UP00164 1 (Hoxa7 2668.2) | E-value |
|---|---|---|
|
GAGGGCAGCCAAGCGTGAC
|
CGAGTTAATTAATAAGC
|
0.33 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2967Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00037 1 (Zfp105 primary)" relative to "MA0014.2 (PAX5)" |
Previous Next Top |
| Primary: MA0014.2 (PAX5) | Secondary: UP00037 1 (Zfp105 primary) | E-value |
|---|---|---|
|
GAGGGCAGCCAAGCGTGAC
|
AACAAACAACAAGAG
|
0.38 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5735Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0087.1 (Sox5)" relative to "MA0014.2 (PAX5)" |
Previous Next Top |
| Primary: MA0014.2 (PAX5) | Secondary: MA0087.1 (Sox5) | E-value |
|---|---|---|
|
GAGGGCAGCCAAGCGTGAC
|
ATTGTTA
|
0.52 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5328Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0505.1 (Nr5a2)" relative to "MA0014.2 (PAX5)" |
Previous Next Top |
| Primary: MA0014.2 (PAX5) | Secondary: MA0505.1 (Nr5a2) | E-value |
|---|---|---|
|
GAGGGCAGCCAAGCGTGAC
|
AAGTTCAAGGTCAGC
|
0.73 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3700Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00035 2 (Hic1 secondary)" relative to "MA0014.2 (PAX5)" |
Previous Next Top |
| Primary: MA0014.2 (PAX5) | Secondary: UP00035 2 (Hic1 secondary) | E-value |
|---|---|---|
|
GAGGGCAGCCAAGCGTGAC
|
GGGTGTGCCCAAAAGG
|
1.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5175Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0599.1 (KLF5)" relative to "MA0014.2 (PAX5)" |
Previous Next Top |
| Primary: MA0014.2 (PAX5) | Secondary: MA0599.1 (KLF5) | E-value |
|---|---|---|
|
GAGGGCAGCCAAGCGTGAC
|
GCCCCGCCCC
|
1.6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6528Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0516.1 (SP2)" relative to "MA0014.2 (PAX5)" |
Previous Next Top |
| Primary: MA0014.2 (PAX5) | Secondary: MA0516.1 (SP2) | E-value |
|---|---|---|
|
GAGGGCAGCCAAGCGTGAC
|
GCCCCGCCCCCTCCC
|
1.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6842Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00172 1 (Prop1 3949.1)" relative to "MA0014.2 (PAX5)" |
Previous Next Top |
| Primary: MA0014.2 (PAX5) | Secondary: UP00172 1 (Prop1 3949.1) | E-value |
|---|---|---|
|
GAGGGCAGCCAAGCGTGAC
|
CGAATTAATTAAGAAAC
|
1.9 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1266Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00079 2 (Esrra secondary)" relative to "MA0014.2 (PAX5)" |
Previous Next Top |
| Primary: MA0014.2 (PAX5) | Secondary: UP00079 2 (Esrra secondary) | E-value |
|---|---|---|
|
GAGGGCAGCCAAGCGTGAC
|
GGCGAGGGGTCAAGGGC
|
2.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4712Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0161.1 (NFIC)" relative to "MA0014.2 (PAX5)" |
Previous Next Top |
| Primary: MA0014.2 (PAX5) | Secondary: MA0161.1 (NFIC) | E-value |
|---|---|---|
|
GAGGGCAGCCAAGCGTGAC
|
TTGGCA
|
2.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif11365Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "GCTGGRGA (DREME)" relative to "MA0014.2 (PAX5)" |
Previous Next Top |
| Primary: MA0014.2 (PAX5) | Secondary: GCTGGRGA (DREME) | E-value |
|---|---|---|
|
GAGGGCAGCCAAGCGTGAC
|
GCTGGAGA
|
2.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif921Motif Databasedreme.xml |
|||||||||||
Spacings of "UP00053 1 (Rxra primary)" relative to "MA0014.2 (PAX5)" |
Previous Next Top |
| Primary: MA0014.2 (PAX5) | Secondary: UP00053 1 (Rxra primary) | E-value |
|---|---|---|
|
GAGGGCAGCCAAGCGTGAC
|
TGTCGTGACCCCTTAAT
|
3.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5171Motif Databaseuniprobe mouse |
|||||||||||
| Similar Secondary: UP00066 1 (Hnf4a primary) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4466Alignment by most significant spacings
|
|||||||||||||||
Spacings of "MA0528.1 (ZNF263)" relative to "MA0014.2 (PAX5)" |
Previous Next Top |
| Primary: MA0014.2 (PAX5) | Secondary: MA0528.1 (ZNF263) | E-value |
|---|---|---|
|
GAGGGCAGCCAAGCGTGAC
|
GGAGGAGGAGGGGGAGGAGGA
|
3.5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6620Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00096 1 (Sox13 primary)" relative to "MA0014.2 (PAX5)" |
Previous Next Top |
| Primary: MA0014.2 (PAX5) | Secondary: UP00096 1 (Sox13 primary) | E-value |
|---|---|---|
|
GAGGGCAGCCAAGCGTGAC
|
TTAAGAACAATAATTT
|
3.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3489Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0052.2 (MEF2A)" relative to "MA0014.2 (PAX5)" |
Previous Next Top |
| Primary: MA0014.2 (PAX5) | Secondary: MA0052.2 (MEF2A) | E-value |
|---|---|---|
|
GAGGGCAGCCAAGCGTGAC
|
AGCTAAAAATAGCAT
|
4.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1627Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00015 1 (Ehf primary)" relative to "MA0014.2 (PAX5)" |
Previous Next Top |
| Primary: MA0014.2 (PAX5) | Secondary: UP00015 1 (Ehf primary) | E-value |
|---|---|---|
|
GAGGGCAGCCAAGCGTGAC
|
AGGACCCGGAAGTAA
|
5.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5586Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0037.2 (GATA3)" relative to "MA0014.2 (PAX5)" |
Previous Next Top |
| Primary: MA0014.2 (PAX5) | Secondary: MA0037.2 (GATA3) | E-value |
|---|---|---|
|
GAGGGCAGCCAAGCGTGAC
|
AGATAAGA
|
6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif802Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0114.2 (HNF4A)" relative to "MA0014.2 (PAX5)" |
Previous Next Top |
| Primary: MA0014.2 (PAX5) | Secondary: MA0114.2 (HNF4A) | E-value |
|---|---|---|
|
GAGGGCAGCCAAGCGTGAC
|
CTGGACTTTGGACTC
|
6.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5531Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00109 1 (Obox6 3440.2)" relative to "MA0014.2 (PAX5)" |
Previous Next Top |
| Primary: MA0014.2 (PAX5) | Secondary: UP00109 1 (Obox6 3440.2) | E-value |
|---|---|---|
|
GAGGGCAGCCAAGCGTGAC
|
AAAAACGGATTATTG
|
7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1215Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00210 1 (Mrg2 2302.1)" relative to "MA0014.2 (PAX5)" |
Previous Next Top |
| Primary: MA0014.2 (PAX5) | Secondary: UP00210 1 (Mrg2 2302.1) | E-value |
|---|---|---|
|
GAGGGCAGCCAAGCGTGAC
|
AATTACCTGTCAATAC
|
7.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3090Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00138 1 (Bsx 3483.2)" relative to "MA0014.2 (PAX5)" |
Previous Next Top |
| Primary: MA0014.2 (PAX5) | Secondary: UP00138 1 (Bsx 3483.2) | E-value |
|---|---|---|
|
GAGGGCAGCCAAGCGTGAC
|
CAGGTAATTACCTCAG
|
8.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2511Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00241 1 (Hoxd3 1742.2)" relative to "MA0014.2 (PAX5)" |
Previous Next Top |
| Primary: MA0014.2 (PAX5) | Secondary: UP00241 1 (Hoxd3 1742.2) | E-value |
|---|---|---|
|
GAGGGCAGCCAAGCGTGAC
|
TTGAGTTAATTAACCT
|
8.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2816Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00103 1 (Jundm2 primary)" relative to "MA0014.2 (PAX5)" |
Previous Next Top |
| Primary: MA0014.2 (PAX5) | Secondary: UP00103 1 (Jundm2 primary) | E-value |
|---|---|---|
|
GAGGGCAGCCAAGCGTGAC
|
CCGATGACGTCATCGT
|
9.5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1041Motif Databaseuniprobe mouse |
|||||||||||