The name of the primary motif.
The logo of the primary motif.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The number of secondary motifs found that had significant spacings in the tested region.
The list of secondary motifs found that had significant spacings in the tested region.
The name of the sequence database.
The last modified date of the sequence database.
The number of sequences in the sequence database.
The number of sequences in the sequence database which were excluded because they were shorter than twice the margin plus the primary motif length.
The number of sequences in the sequence database which were excluded because no match to the primary motif could be found at a distance to the edges larger than the margin.
The number of sequences in the sequence database which were excluded because they were largly identical to other sequences when aligned on the primary motif site.
The number of sequences which were scanned with the secondary motifs.
The name of the motif database derived from the file name.
The date that the motif database was last modified.
The number of motifs loaded from the motif database. Some motifs may have been excluded.
The number of motifs with significant E-values whose significant spacings were not considered too similar to those of another motif.
The number of motifs that while having significant spacings were less signficant than another motif that matched most of the same sites.
The primary motif is used as the reference point for all spacing calculation.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The secondary motif occurs at the spacings relative to the primary shown in the histogram below.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The E-value is the lowest p-value of any spacing of the secondary motif times the number of secondary motifs. It estimates the expected number of random secondary motifs that would have the observed minimum p-value or less.
The histogram below shows the frequency of spacings from the primary motif to the secondary motif. Red bars indicate that a spacing has occured a statistically significant number of times.
The details of the significant spacings are shown in the four quadrants as they relate to the quadrants of the graph.
The total number of sequences that have a match for both the primary motif and this secondary motif.
The motif database which this secondary motif came from.
The list of secondary motifs which have been identified as possibly similar to this motif because their most significant spacings overlaped with the most significant spacing of this motif. Check the boxes to show the possibly similar secondary motifs.
This shows the first secondary motif aligned with the current secondary motif by the most significant spacing.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
For further information on how to interpret these results or to get a copy of the MEME software please access http://meme.nbcr.net.
If you use SpaMo in your research please cite the following paper:
Tom Whitington, Martin C. Frith, James Johnson and Timothy L. Bailey,
"Inferring transcription factor complexes from ChIP-seq data",
Nucleic Acids Research, 39(15):e98, 2011.
[full text]
Primary Motif |
Next Top |
Sequence Database |
Previous Next Top |
| Name | Last Modified | Loaded | Too Short | No Primary | Too Similar | Used |
|---|---|---|---|---|---|---|
| Static Sex-independent | Wed Jun 7 10:47:08 2017 | 67058 | 0 | 50633 | 2 | 16423 |
Secondary Databases |
Previous Next Top |
| Name | Last Modified | Number of Motifs | Motifs Significant | Motifs Redundant |
|---|---|---|---|---|
| meme.xml | Wed Jun 7 10:49:30 2017 | 3 | 0 | 0 |
| dreme.xml | Wed Jun 7 15:52:22 2017 | 62 | 4 | 1 |
| JASPAR CORE 2014 vertebrates | Wed Jun 7 10:46:42 2017 | 205 | 19 | 1 |
| uniprobe mouse | Wed Jun 7 10:46:42 2017 | 386 | 44 | 5 |
Spacings of "UP00039 1 (Foxj3 primary)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00039 1 (Foxj3 primary) | E-value |
|---|---|---|
|
TTATCT
|
AAAAAGTAAACAAACCC
|
4.1e-17 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6947Motif Databaseuniprobe mouse |
|||||||||||
| Similar Secondary: UP00041 1 (Foxj1 primary) | |||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif9867Alignment by most significant spacings
|
|||||||||||||||||||||||
| Similar Secondary: RTAAAYA (DREME) | |||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3622Alignment by most significant spacings
|
|||||||||||||||||||||||||||
Spacings of "MA0442.1 (SOX10)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: MA0442.1 (SOX10) | E-value |
|---|---|---|
|
TTATCT
|
CTTTGT
|
5.3e-08 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif14886Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0041.1 (Foxd3)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: MA0041.1 (Foxd3) | E-value |
|---|---|---|
|
TTATCT
|
GAATGTTTGTTT
|
7.4e-08 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7184Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||||||||||
Spacings of "UP00161 1 (Hmbox1 2674.1)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00161 1 (Hmbox1 2674.1) | E-value |
|---|---|---|
|
TTATCT
|
GAAAACTAGTTAACATC
|
2.7e-06 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4554Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0124.1 (NKX3-1)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: MA0124.1 (NKX3-1) | E-value |
|---|---|---|
|
TTATCT
|
ATACTTA
|
0.00011 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4233Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00126 1 (Dlx2 2273.2)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00126 1 (Dlx2 2273.2) | E-value |
|---|---|---|
|
TTATCT
|
GGAATAATTACTTCAG
|
0.00011 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4098Motif Databaseuniprobe mouse |
|||||||||||
| Similar Secondary: UP00154 1 (Dlx3 1030.1) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2862Alignment by most significant spacings
|
|||||||||||||||
Spacings of "MA0042.1 (FOXI1)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: MA0042.1 (FOXI1) | E-value |
|---|---|---|
|
TTATCT
|
GGATGTTTGTTT
|
0.00098 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5057Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||
Spacings of "UP00037 1 (Zfp105 primary)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00037 1 (Zfp105 primary) | E-value |
|---|---|---|
|
TTATCT
|
AACAAACAACAAGAG
|
0.0017 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif10608Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "UP00077 2 (Srf secondary)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00077 2 (Srf secondary) | E-value |
|---|---|---|
|
TTATCT
|
GTTAAAAAAAAAAATTT
|
0.0024 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif9772Motif Databaseuniprobe mouse |
|||||||||||||||||||||||||||||||||||
Spacings of "MA0084.1 (SRY)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: MA0084.1 (SRY) | E-value |
|---|---|---|
|
TTATCT
|
GTAAACAAT
|
0.0024 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif11987Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||||||||||
Spacings of "UP00407 2 (Elf3 secondary)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00407 2 (Elf3 secondary) | E-value |
|---|---|---|
|
TTATCT
|
GTTCAAAAAAAAAATTC
|
0.0066 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif9708Motif Databaseuniprobe mouse |
|||||||||||||||||||||||||||
Spacings of "UP00078 1 (Arid3a primary)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00078 1 (Arid3a primary) | E-value |
|---|---|---|
|
TTATCT
|
GGGTTTAATTAAAATTC
|
0.018 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7390Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0148.3 (FOXA1)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: MA0148.3 (FOXA1) | E-value |
|---|---|---|
|
TTATCT
|
TCCATGTTTACTTTG
|
0.029 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6268Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||
Spacings of "UP00162 1 (Evx1 3952.2)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00162 1 (Evx1 3952.2) | E-value |
|---|---|---|
|
TTATCT
|
AGAACTAATTAGTGGAC
|
0.036 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3316Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00083 2 (Tcf7l2 secondary)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00083 2 (Tcf7l2 secondary) | E-value |
|---|---|---|
|
TTATCT
|
GAAGATCAATCACTAA
|
0.037 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6101Motif Databaseuniprobe mouse |
|||||||||||
| Similar Secondary: UP00067 2 (Lef1 secondary) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6033Alignment by most significant spacings
|
|||||||||||||||
Spacings of "UP00164 1 (Hoxa7 2668.2)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00164 1 (Hoxa7 2668.2) | E-value |
|---|---|---|
|
TTATCT
|
CGAGTTAATTAATAAGC
|
0.067 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6102Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0030.1 (FOXF2)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: MA0030.1 (FOXF2) | E-value |
|---|---|---|
|
TTATCT
|
CAAACGTAAACAAT
|
0.096 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2468Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||||||
Spacings of "UP00071 1 (Sox21 primary)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00071 1 (Sox21 primary) | E-value |
|---|---|---|
|
TTATCT
|
TTTAATTATAATTAAG
|
0.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5710Motif Databaseuniprobe mouse |
|||||||||||||||||||||||
Spacings of "MA0077.1 (SOX9)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: MA0077.1 (SOX9) | E-value |
|---|---|---|
|
TTATCT
|
CCATTGTTC
|
0.11 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7731Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00029 1 (Tbp primary)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00029 1 (Tbp primary) | E-value |
|---|---|---|
|
TTATCT
|
TCTTTATATATAAATA
|
0.12 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5709Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "MA0151.1 (ARID3A)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: MA0151.1 (ARID3A) | E-value |
|---|---|---|
|
TTATCT
|
ATTAAA
|
0.16 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8321Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00075 1 (Sox15 primary)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00075 1 (Sox15 primary) | E-value |
|---|---|---|
|
TTATCT
|
TAGTGAACAATAGATTT
|
0.16 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7870Motif Databaseuniprobe mouse |
|||||||||||||||
| Similar Secondary: UP00071 2 (Sox21 secondary) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8613Alignment by most significant spacings
|
|||||||||||||||
| Similar Secondary: UP00091 1 (Sox5 primary) | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6288Alignment by most significant spacings
|
|||||||||||||||||||
Spacings of "UP00061 1 (Foxl1 primary)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00061 1 (Foxl1 primary) | E-value |
|---|---|---|
|
TTATCT
|
TAAATGTAAACAAAGGT
|
0.16 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5381Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0108.2 (TBP)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: MA0108.2 (TBP) | E-value |
|---|---|---|
|
TTATCT
|
GTATAAAAGGCGGGG
|
0.16 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7203Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "RAGKTCA (DREME)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: RAGKTCA (DREME) | E-value |
|---|---|---|
|
TTATCT
|
AAGGTCA
|
0.19 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5331Motif Databasedreme.xml |
|||||||||||
Spacings of "UP00124 1 (Ipf1 3815.1)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00124 1 (Ipf1 3815.1) | E-value |
|---|---|---|
|
TTATCT
|
AAGGTAATTAGCTCAT
|
0.22 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4259Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0155.1 (INSM1)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: MA0155.1 (INSM1) | E-value |
|---|---|---|
|
TTATCT
|
TGTCAGGGGGCG
|
0.23 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2381Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0076.2 (ELK4)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: MA0076.2 (ELK4) | E-value |
|---|---|---|
|
TTATCT
|
CCACTTCCGGC
|
0.28 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5683Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
| Similar Secondary: MA0475.1 (FLI1) | |||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7362Alignment by most significant spacings
|
|||||||||||||||||||||||
Spacings of "UP00223 2 (Irx3 2226.1)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00223 2 (Irx3 2226.1) | E-value |
|---|---|---|
|
TTATCT
|
AATATACATGTAATATT
|
0.3 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2990Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0089.1 (NFE2L1::MafG)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: MA0089.1 (NFE2L1::MafG) | E-value |
|---|---|---|
|
TTATCT
|
CATGAC
|
0.37 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif9778Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00136 1 (Prrx2 3072.1)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00136 1 (Prrx2 3072.1) | E-value |
|---|---|---|
|
TTATCT
|
AAAGCTAATTAGCGAAA
|
0.43 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1977Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0474.1 (Erg)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: MA0474.1 (Erg) | E-value |
|---|---|---|
|
TTATCT
|
ACAGGAAGTGG
|
0.59 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7881Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00050 2 (Bhlhb2 secondary)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00050 2 (Bhlhb2 secondary) | E-value |
|---|---|---|
|
TTATCT
|
TGTCGTTACACGTGGAAGGCGGT
|
0.61 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1478Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00207 1 (Hoxb9 3413.1)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00207 1 (Hoxb9 3413.1) | E-value |
|---|---|---|
|
TTATCT
|
GGAGCCATAAAATTCG
|
0.78 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5627Motif Databaseuniprobe mouse |
|||||||||||||||
Spacings of "UP00211 1 (Pou3f3 3235.2)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00211 1 (Pou3f3 3235.2) | E-value |
|---|---|---|
|
TTATCT
|
AAAATATGCATAATAAA
|
1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3401Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00171 1 (Msx3 3206.1)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00171 1 (Msx3 3206.1) | E-value |
|---|---|---|
|
TTATCT
|
CAAAACCAATTAATTT
|
1.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3216Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00150 1 (Irx6 2623.2)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00150 1 (Irx6 2623.2) | E-value |
|---|---|---|
|
TTATCT
|
AAAATACATGTAAAAAT
|
1.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3133Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "UP00244 1 (Tlx2 3498.2)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00244 1 (Tlx2 3498.2) | E-value |
|---|---|---|
|
TTATCT
|
TAATTAATTAATAACTT
|
1.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6487Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00039 2 (Foxj3 secondary)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00039 2 (Foxj3 secondary) | E-value |
|---|---|---|
|
TTATCT
|
AACACCAAAACAAAGGA
|
1.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif9512Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00086 1 (Irf3 primary)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00086 1 (Irf3 primary) | E-value |
|---|---|---|
|
TTATCT
|
GAGAACCGAAACTG
|
1.3 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8056Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00254 1 (Pou2f1 3081.2)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00254 1 (Pou2f1 3081.2) | E-value |
|---|---|---|
|
TTATCT
|
ATGTATTAATTAAGTA
|
1.6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5172Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00141 1 (Vsx1 1728.1)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00141 1 (Vsx1 1728.1) | E-value |
|---|---|---|
|
TTATCT
|
CGAGTTAATTAATAATT
|
1.9 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2722Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00129 1 (Pou3f1 3819.1)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00129 1 (Pou3f1 3819.1) | E-value |
|---|---|---|
|
TTATCT
|
AATTAATTAATTAATTC
|
2.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3346Motif Databaseuniprobe mouse |
|||||||||||||||||||||||
Spacings of "UP00158 1 (Pou1f1 3818.1)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00158 1 (Pou1f1 3818.1) | E-value |
|---|---|---|
|
TTATCT
|
GATTAATTAATTAAGTC
|
2.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3714Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00178 1 (Og2x 3719.1)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00178 1 (Og2x 3719.1) | E-value |
|---|---|---|
|
TTATCT
|
CGCGCTAATTAGGTATC
|
2.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3716Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "UP00024 2 (Glis2 secondary)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00024 2 (Glis2 secondary) | E-value |
|---|---|---|
|
TTATCT
|
AATATTAATAAAGA
|
2.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8063Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00051 1 (Sox8 primary)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00051 1 (Sox8 primary) | E-value |
|---|---|---|
|
TTATCT
|
TTATCTATTGTTCTTTA
|
2.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8167Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "TTTAWW (DREME)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: TTTAWW (DREME) | E-value |
|---|---|---|
|
TTATCT
|
TTTAAT
|
3.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8023Motif Databasedreme.xml |
|||||||||||||||||||
Spacings of "UP00073 2 (Foxa2 secondary)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00073 2 (Foxa2 secondary) | E-value |
|---|---|---|
|
TTATCT
|
AAAAATAACAAACGG
|
3.3 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif9716Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "UP00012 1 (Bbx primary)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00012 1 (Bbx primary) | E-value |
|---|---|---|
|
TTATCT
|
TAATTCAATGAAGTG
|
3.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6742Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "MA0087.1 (Sox5)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: MA0087.1 (Sox5) | E-value |
|---|---|---|
|
TTATCT
|
ATTGTTA
|
3.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif9176Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00034 1 (Sox7 primary)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00034 1 (Sox7 primary) | E-value |
|---|---|---|
|
TTATCT
|
AATAAAGAACAATAGAATTTCA
|
4.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6981Motif Databaseuniprobe mouse |
|||||||||||||||
Spacings of "UP00025 1 (Foxk1 primary)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00025 1 (Foxk1 primary) | E-value |
|---|---|---|
|
TTATCT
|
AAAATGTAAACAAACAG
|
4.6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5789Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00241 1 (Hoxd3 1742.2)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00241 1 (Hoxd3 1742.2) | E-value |
|---|---|---|
|
TTATCT
|
TTGAGTTAATTAACCT
|
4.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5463Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "GCTGGRGA (DREME)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: GCTGGRGA (DREME) | E-value |
|---|---|---|
|
TTATCT
|
GCTGGAGA
|
5.9 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1009Motif Databasedreme.xml |
|||||||||||
Spacings of "MA0047.2 (Foxa2)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: MA0047.2 (Foxa2) | E-value |
|---|---|---|
|
TTATCT
|
TGTTTACTTAGG
|
6.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6981Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "AAATAY (DREME)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: AAATAY (DREME) | E-value |
|---|---|---|
|
TTATCT
|
AAATAC
|
6.6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4779Motif Databasedreme.xml |
|||||||||||
Spacings of "UP00225 1 (Hlx1 2350.1)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00225 1 (Hlx1 2350.1) | E-value |
|---|---|---|
|
TTATCT
|
CCATAATTAATTACA
|
6.9 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5668Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00391 2 (Hoxa3 secondary)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00391 2 (Hoxa3 secondary) | E-value |
|---|---|---|
|
TTATCT
|
AAAAACCATTAAGG
|
7.5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6996Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00073 1 (Foxa2 primary)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00073 1 (Foxa2 primary) | E-value |
|---|---|---|
|
TTATCT
|
AAAAAGTAAACAAAGAC
|
7.9 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7063Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "MA0593.1 (FOXP2)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: MA0593.1 (FOXP2) | E-value |
|---|---|---|
|
TTATCT
|
AAGTAAACAAA
|
8.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4770Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0505.1 (Nr5a2)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: MA0505.1 (Nr5a2) | E-value |
|---|---|---|
|
TTATCT
|
AAGTTCAAGGTCAGC
|
8.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5341Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00151 1 (Barx2 3447.2)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00151 1 (Barx2 3447.2) | E-value |
|---|---|---|
|
TTATCT
|
TAAGTAATTAGTTATA
|
9.6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3727Motif Databaseuniprobe mouse |
|||||||||||||||
Spacings of "UP00255 1 (Dbx1 3486.1)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00255 1 (Dbx1 3486.1) | E-value |
|---|---|---|
|
TTATCT
|
TAATTAATTAATAATTA
|
9.6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8168Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00050 1 (Bhlhb2 primary)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00050 1 (Bhlhb2 primary) | E-value |
|---|---|---|
|
TTATCT
|
GGAAGAGTCACGTGACCAATAC
|
9.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2057Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00060 1 (Max primary)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: UP00060 1 (Max primary) | E-value |
|---|---|---|
|
TTATCT
|
TGACCACGTGGTCGGG
|
10 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3196Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0478.1 (FOSL2)" relative to "TTATYW (DREME)" |
Previous Next Top |
| Primary: TTATYW (DREME) | Secondary: MA0478.1 (FOSL2) | E-value |
|---|---|---|
|
TTATCT
|
GGATGACTCAT
|
10 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2607Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||