The name of the primary motif.
The logo of the primary motif.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The number of secondary motifs found that had significant spacings in the tested region.
The list of secondary motifs found that had significant spacings in the tested region.
The name of the sequence database.
The last modified date of the sequence database.
The number of sequences in the sequence database.
The number of sequences in the sequence database which were excluded because they were shorter than twice the margin plus the primary motif length.
The number of sequences in the sequence database which were excluded because no match to the primary motif could be found at a distance to the edges larger than the margin.
The number of sequences in the sequence database which were excluded because they were largly identical to other sequences when aligned on the primary motif site.
The number of sequences which were scanned with the secondary motifs.
The name of the motif database derived from the file name.
The date that the motif database was last modified.
The number of motifs loaded from the motif database. Some motifs may have been excluded.
The number of motifs with significant E-values whose significant spacings were not considered too similar to those of another motif.
The number of motifs that while having significant spacings were less signficant than another motif that matched most of the same sites.
The primary motif is used as the reference point for all spacing calculation.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The secondary motif occurs at the spacings relative to the primary shown in the histogram below.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The E-value is the lowest p-value of any spacing of the secondary motif times the number of secondary motifs. It estimates the expected number of random secondary motifs that would have the observed minimum p-value or less.
The histogram below shows the frequency of spacings from the primary motif to the secondary motif. Red bars indicate that a spacing has occured a statistically significant number of times.
The details of the significant spacings are shown in the four quadrants as they relate to the quadrants of the graph.
The total number of sequences that have a match for both the primary motif and this secondary motif.
The motif database which this secondary motif came from.
The list of secondary motifs which have been identified as possibly similar to this motif because their most significant spacings overlaped with the most significant spacing of this motif. Check the boxes to show the possibly similar secondary motifs.
This shows the first secondary motif aligned with the current secondary motif by the most significant spacing.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
For further information on how to interpret these results or to get a copy of the MEME software please access http://meme.nbcr.net.
If you use SpaMo in your research please cite the following paper:
Tom Whitington, Martin C. Frith, James Johnson and Timothy L. Bailey,
"Inferring transcription factor complexes from ChIP-seq data",
Nucleic Acids Research, 39(15):e98, 2011.
[full text]
Primary Motif |
Next Top |
| Name | Preview | Significant Secondaries | List |
|---|---|---|---|
| AGRDGGCG (DREME) |
AGGGGGCG
|
58 | STGGCCA (DREME), MA0130.1 (ZNF354C), MA0019.1 (Ddit3::Cebpa), UP00047 2 (Zbtb7b secondary), AGGHCA (DREME), MA0161.1 (NFIC), WGCCAR (DREME), MA0145.2 (Tcfcp2l1), UP00031 1 (Zbtb3 primary), CTGGGYW (DREME), MA0133.1 (BRCA1), UP00044 2 (Mafk secondary), UP00066 2 (Hnf4a secondary), MA0093.2 (USF1), 1 (MEME), CSTCCTCC (DREME), MA0152.1 (NFATC2), UP00087 2 (Tcfap2c secondary), MA0516.1 (SP2), MA0027.1 (En1) |
Sequence Database |
Previous Next Top |
| Name | Last Modified | Loaded | Too Short | No Primary | Too Similar | Used |
|---|---|---|---|---|---|---|
| Static Sex-independent | Wed Jun 7 10:47:08 2017 | 67058 | 0 | 62036 | 0 | 5022 |
Secondary Databases |
Previous Next Top |
| Name | Last Modified | Number of Motifs | Motifs Significant | Motifs Redundant |
|---|---|---|---|---|
| meme.xml | Wed Jun 7 10:49:30 2017 | 3 | 1 | 0 |
| dreme.xml | Wed Jun 7 15:52:22 2017 | 62 | 10 | 0 |
| JASPAR CORE 2014 vertebrates | Wed Jun 7 10:46:42 2017 | 205 | 20 | 6 |
| uniprobe mouse | Wed Jun 7 10:46:42 2017 | 386 | 27 | 2 |
Spacings of "STGGCCA (DREME)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: STGGCCA (DREME) | E-value |
|---|---|---|
|
AGGGGGCG
|
CTGGCCA
|
3.1e-59 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif623Motif Databasedreme.xml |
|||||||||||||||||||
Spacings of "MA0130.1 (ZNF354C)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: MA0130.1 (ZNF354C) | E-value |
|---|---|---|
|
AGGGGGCG
|
ATCCAC
|
7.7e-48 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3753Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0019.1 (Ddit3::Cebpa)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: MA0019.1 (Ddit3::Cebpa) | E-value |
|---|---|---|
|
AGGGGGCG
|
AGATGCAATCCC
|
3e-31 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1100Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00047 2 (Zbtb7b secondary)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: UP00047 2 (Zbtb7b secondary) | E-value |
|---|---|---|
|
AGGGGGCG
|
CTTAAGACCACCATTAC
|
1.3e-30 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1664Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "AGGHCA (DREME)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: AGGHCA (DREME) | E-value |
|---|---|---|
|
AGGGGGCG
|
AGGCCA
|
1.1e-29 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2531Motif Databasedreme.xml |
|||||||||||||||||||||||||||
| Similar Secondary: MA0160.1 (NR4A2) | |||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2676Alignment by most significant spacings
|
|||||||||||||||||||||||
| Similar Secondary: MA0512.1 (Rxra) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1887Alignment by most significant spacings
|
|||||||||||||||
| Similar Secondary: MA0114.2 (HNF4A) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1644Alignment by most significant spacings
|
|||||||||||||||
| Similar Secondary: MA0484.1 (HNF4G) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1745Alignment by most significant spacings
|
|||||||||||||||
Spacings of "MA0161.1 (NFIC)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: MA0161.1 (NFIC) | E-value |
|---|---|---|
|
AGGGGGCG
|
TTGGCA
|
2.9e-27 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4326Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||||||
Spacings of "WGCCAR (DREME)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: WGCCAR (DREME) | E-value |
|---|---|---|
|
AGGGGGCG
|
AGCCAG
|
4.8e-23 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3210Motif Databasedreme.xml |
|||||||||||
Spacings of "MA0145.2 (Tcfcp2l1)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: MA0145.2 (Tcfcp2l1) | E-value |
|---|---|---|
|
AGGGGGCG
|
CCAGTTCAAACCAG
|
6.7e-22 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2323Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00031 1 (Zbtb3 primary)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: UP00031 1 (Zbtb3 primary) | E-value |
|---|---|---|
|
AGGGGGCG
|
AATCGCACTGCATTCCG
|
6.8e-16 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2140Motif Databaseuniprobe mouse |
|||||||||||||||
Spacings of "CTGGGYW (DREME)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: CTGGGYW (DREME) | E-value |
|---|---|---|
|
AGGGGGCG
|
CTGGGCT
|
8.5e-06 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1429Motif Databasedreme.xml |
|||||||||||
Spacings of "MA0133.1 (BRCA1)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: MA0133.1 (BRCA1) | E-value |
|---|---|---|
|
AGGGGGCG
|
ACAACAC
|
1.5e-05 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2279Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||||||
Spacings of "UP00044 2 (Mafk secondary)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: UP00044 2 (Mafk secondary) | E-value |
|---|---|---|
|
AGGGGGCG
|
GAAAAAATTGCAAGG
|
3e-05 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1305Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00066 2 (Hnf4a secondary)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: UP00066 2 (Hnf4a secondary) | E-value |
|---|---|---|
|
AGGGGGCG
|
TGCAAAAGTCCAATAT
|
8.3e-05 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif917Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0093.2 (USF1)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: MA0093.2 (USF1) | E-value |
|---|---|---|
|
AGGGGGCG
|
GCCACGTGACC
|
0.00021 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif988Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "1 (MEME)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: 1 (MEME) | E-value |
|---|---|---|
|
AGGGGGCG
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
0.0028 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2557Motif Databasememe.xml |
|||||||||||||||||||
Spacings of "CSTCCTCC (DREME)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: CSTCCTCC (DREME) | E-value |
|---|---|---|
|
AGGGGGCG
|
CCTCCTCC
|
0.0044 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif585Motif Databasedreme.xml |
|||||||||||||||
Spacings of "MA0152.1 (NFATC2)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: MA0152.1 (NFATC2) | E-value |
|---|---|---|
|
AGGGGGCG
|
TTTTCCA
|
0.0064 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2876Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00087 2 (Tcfap2c secondary)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: UP00087 2 (Tcfap2c secondary) | E-value |
|---|---|---|
|
AGGGGGCG
|
CCGCCCAAGGGCAG
|
0.011 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2642Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0516.1 (SP2)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: MA0516.1 (SP2) | E-value |
|---|---|---|
|
AGGGGGCG
|
GCCCCGCCCCCTCCC
|
0.018 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3236Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||||||
| Similar Secondary: MA0079.3 (SP1) | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3148Alignment by most significant spacings
|
|||||||||||||||||||
Spacings of "MA0027.1 (En1)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: MA0027.1 (En1) | E-value |
|---|---|---|
|
AGGGGGCG
|
AAGTAGTGCCC
|
0.035 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2131Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||||||
Spacings of "UP00035 1 (Hic1 primary)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: UP00035 1 (Hic1 primary) | E-value |
|---|---|---|
|
AGGGGGCG
|
ACTATGCCAACCTACC
|
0.061 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1317Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "UP00092 2 (Myb secondary)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: UP00092 2 (Myb secondary) | E-value |
|---|---|---|
|
AGGGGGCG
|
CGACCAACTGCCATGC
|
0.12 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1183Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00021 1 (Zfp281 primary)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: UP00021 1 (Zfp281 primary) | E-value |
|---|---|---|
|
AGGGGGCG
|
TCCCCCCCCCCCCCC
|
0.15 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2543Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0117.1 (Mafb)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: MA0117.1 (Mafb) | E-value |
|---|---|---|
|
AGGGGGCG
|
GCTGACGC
|
0.17 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2428Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00006 2 (Zic3 secondary)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: UP00006 2 (Zic3 secondary) | E-value |
|---|---|---|
|
AGGGGGCG
|
GAGCACAGCAGGACA
|
0.19 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2384Motif Databaseuniprobe mouse |
|||||||||||
| Similar Secondary: UP00102 2 (Zic1 secondary) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2429Alignment by most significant spacings
|
|||||||||||||||
| Similar Secondary: UP00057 2 (Zic2 secondary) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2458Alignment by most significant spacings
|
|||||||||||||||
Spacings of "MA0067.1 (Pax2)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: MA0067.1 (Pax2) | E-value |
|---|---|---|
|
AGGGGGCG
|
AGTCACGC
|
0.21 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1942Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "CYGCCDCC (DREME)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: CYGCCDCC (DREME) | E-value |
|---|---|---|
|
AGGGGGCG
|
CTGCCGCC
|
0.21 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1472Motif Databasedreme.xml |
|||||||||||
Spacings of "UP00065 2 (Zfp161 secondary)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: UP00065 2 (Zfp161 secondary) | E-value |
|---|---|---|
|
AGGGGGCG
|
GCCGCGCAGTGCGT
|
0.27 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1920Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00093 1 (Klf7 primary)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: UP00093 1 (Klf7 primary) | E-value |
|---|---|---|
|
AGGGGGCG
|
TCGACCCCGCCCCTAT
|
0.32 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3004Motif Databaseuniprobe mouse |
|||||||||||||||
| Similar Secondary: MA0599.1 (KLF5) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3037Alignment by most significant spacings
|
|||||||||||||||
Spacings of "MA0112.2 (ESR1)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: MA0112.2 (ESR1) | E-value |
|---|---|---|
|
AGGGGGCG
|
GGCCCAGGTCACCCTGACCT
|
0.42 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1702Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "CYCCDCCC (DREME)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: CYCCDCCC (DREME) | E-value |
|---|---|---|
|
AGGGGGCG
|
CCCCTCCC
|
0.49 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2065Motif Databasedreme.xml |
|||||||||||
Spacings of "MA0140.2 (TAL1::GATA1)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: MA0140.2 (TAL1::GATA1) | E-value |
|---|---|---|
|
AGGGGGCG
|
CTTATCTGTGAGGAGCAG
|
0.54 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif415Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "ATCGATH (DREME)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: ATCGATH (DREME) | E-value |
|---|---|---|
|
AGGGGGCG
|
ATCGATC
|
0.68 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif49Motif Databasedreme.xml |
|||||||||||
Spacings of "UP00035 2 (Hic1 secondary)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: UP00035 2 (Hic1 secondary) | E-value |
|---|---|---|
|
AGGGGGCG
|
GGGTGTGCCCAAAAGG
|
0.72 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1878Motif Databaseuniprobe mouse |
|||||||||||||||
Spacings of "MA0162.2 (EGR1)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: MA0162.2 (EGR1) | E-value |
|---|---|---|
|
AGGGGGCG
|
CCCCCGCCCCCGCC
|
0.75 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2862Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||||||
Spacings of "MA0056.1 (MZF1 1-4)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: MA0056.1 (MZF1 1-4) | E-value |
|---|---|---|
|
AGGGGGCG
|
TGGGGA
|
0.78 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3294Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0068.1 (Pax4)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: MA0068.1 (Pax4) | E-value |
|---|---|---|
|
AGGGGGCG
|
GAAAAATTTCCCATACTCCACTCCCCCCCC
|
0.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1419Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00217 1 (Hoxa10 2318.1)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: UP00217 1 (Hoxa10 2318.1) | E-value |
|---|---|---|
|
AGGGGGCG
|
TAGGTAATAAAATTCA
|
0.88 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif971Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "MA0092.1 (Hand1::Tcfe2a)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: MA0092.1 (Hand1::Tcfe2a) | E-value |
|---|---|---|
|
AGGGGGCG
|
GGTCTGGCAT
|
0.92 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2685Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00010 2 (Tcfap2b secondary)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: UP00010 2 (Tcfap2b secondary) | E-value |
|---|---|---|
|
AGGGGGCG
|
ATTGCCTCAGGCAAT
|
1.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2416Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00060 2 (Max secondary)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: UP00060 2 (Max secondary) | E-value |
|---|---|---|
|
AGGGGGCG
|
GTGCCACGCGACTG
|
1.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1935Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00015 2 (Ehf secondary)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: UP00015 2 (Ehf secondary) | E-value |
|---|---|---|
|
AGGGGGCG
|
TAGTATTTCCGATCTT
|
1.9 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1243Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00000 2 (Smad3 secondary)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: UP00000 2 (Smad3 secondary) | E-value |
|---|---|---|
|
AGGGGGCG
|
TACGCCCCGCCACTCTG
|
2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3146Motif Databaseuniprobe mouse |
|||||||||||||||||||||||||||
Spacings of "CHGGRA (DREME)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: CHGGRA (DREME) | E-value |
|---|---|---|
|
AGGGGGCG
|
CTGGGA
|
2.5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4172Motif Databasedreme.xml |
|||||||||||||||
Spacings of "UP00046 2 (Tcfe2a secondary)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: UP00046 2 (Tcfe2a secondary) | E-value |
|---|---|---|
|
AGGGGGCG
|
AAGGCCAGATGGTCCGG
|
3.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2130Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "AAARMAAA (DREME)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: AAARMAAA (DREME) | E-value |
|---|---|---|
|
AGGGGGCG
|
AAAAAAAA
|
3.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif573Motif Databasedreme.xml |
|||||||||||
Spacings of "UP00085 1 (Sfpi1 primary)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: UP00085 1 (Sfpi1 primary) | E-value |
|---|---|---|
|
AGGGGGCG
|
TTAAGAGGAAGTTA
|
4.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2712Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0102.3 (CEBPA)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: MA0102.3 (CEBPA) | E-value |
|---|---|---|
|
AGGGGGCG
|
ATTGCACAATA
|
4.6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif766Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0147.2 (Myc)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: MA0147.2 (Myc) | E-value |
|---|---|---|
|
AGGGGGCG
|
CCATGTGCTT
|
5.3 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif595Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0136.1 (ELF5)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: MA0136.1 (ELF5) | E-value |
|---|---|---|
|
AGGGGGCG
|
TACTTCCTT
|
5.5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3723Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00028 1 (Tcfap2e primary)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: UP00028 1 (Tcfap2e primary) | E-value |
|---|---|---|
|
AGGGGGCG
|
ATTGCCTGAGGCGAT
|
7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2238Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00058 1 (Tcf3 primary)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: UP00058 1 (Tcf3 primary) | E-value |
|---|---|---|
|
AGGGGGCG
|
TATAGATCAAAGGAAAA
|
7.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1468Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00097 2 (Mtf1 secondary)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: UP00097 2 (Mtf1 secondary) | E-value |
|---|---|---|
|
AGGGGGCG
|
AAATAAGAAAAAAC
|
7.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1254Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00078 1 (Arid3a primary)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: UP00078 1 (Arid3a primary) | E-value |
|---|---|---|
|
AGGGGGCG
|
GGGTTTAATTAAAATTC
|
7.6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1026Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00075 2 (Sox15 secondary)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: UP00075 2 (Sox15 secondary) | E-value |
|---|---|---|
|
AGGGGGCG
|
TTGAATGAAATTCGA
|
7.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1236Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00014 1 (Sox17 primary)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: UP00014 1 (Sox17 primary) | E-value |
|---|---|---|
|
AGGGGGCG
|
ATAAACAATTAATCA
|
8.3 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1031Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00101 1 (Sox12 primary)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: UP00101 1 (Sox12 primary) | E-value |
|---|---|---|
|
AGGGGGCG
|
TAATTGTTCTAAAC
|
8.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1253Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00114 1 (Homez 1063.2)" relative to "AGRDGGCG (DREME)" |
Previous Next Top |
| Primary: AGRDGGCG (DREME) | Secondary: UP00114 1 (Homez 1063.2) | E-value |
|---|---|---|
|
AGGGGGCG
|
AAAACATCGTTTTTAAG
|
9.5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif456Motif Databaseuniprobe mouse |
|||||||||||