The name of the primary motif.
The logo of the primary motif.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The number of secondary motifs found that had significant spacings in the tested region.
The list of secondary motifs found that had significant spacings in the tested region.
The name of the sequence database.
The last modified date of the sequence database.
The number of sequences in the sequence database.
The number of sequences in the sequence database which were excluded because they were shorter than twice the margin plus the primary motif length.
The number of sequences in the sequence database which were excluded because no match to the primary motif could be found at a distance to the edges larger than the margin.
The number of sequences in the sequence database which were excluded because they were largly identical to other sequences when aligned on the primary motif site.
The number of sequences which were scanned with the secondary motifs.
The name of the motif database derived from the file name.
The date that the motif database was last modified.
The number of motifs loaded from the motif database. Some motifs may have been excluded.
The number of motifs with significant E-values whose significant spacings were not considered too similar to those of another motif.
The number of motifs that while having significant spacings were less signficant than another motif that matched most of the same sites.
The primary motif is used as the reference point for all spacing calculation.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The secondary motif occurs at the spacings relative to the primary shown in the histogram below.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The E-value is the lowest p-value of any spacing of the secondary motif times the number of secondary motifs. It estimates the expected number of random secondary motifs that would have the observed minimum p-value or less.
The histogram below shows the frequency of spacings from the primary motif to the secondary motif. Red bars indicate that a spacing has occured a statistically significant number of times.
The details of the significant spacings are shown in the four quadrants as they relate to the quadrants of the graph.
The total number of sequences that have a match for both the primary motif and this secondary motif.
The motif database which this secondary motif came from.
The list of secondary motifs which have been identified as possibly similar to this motif because their most significant spacings overlaped with the most significant spacing of this motif. Check the boxes to show the possibly similar secondary motifs.
This shows the first secondary motif aligned with the current secondary motif by the most significant spacing.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
For further information on how to interpret these results or to get a copy of the MEME software please access http://meme.nbcr.net.
If you use SpaMo in your research please cite the following paper:
Tom Whitington, Martin C. Frith, James Johnson and Timothy L. Bailey,
"Inferring transcription factor complexes from ChIP-seq data",
Nucleic Acids Research, 39(15):e98, 2011.
[full text]
Primary Motif |
Next Top |
| Name | Preview | Significant Secondaries | List |
|---|---|---|---|
| MA0062.2 (GABPA) |
CCGGAAGTGGC
|
42 | MA0139.1 (CTCF), UP00021 1 (Zfp281 primary), UP00407 2 (Elf3 secondary), UP00077 2 (Srf secondary), UP00033 2 (Zfp410 secondary), MA0516.1 (SP2), VGGAAR (DREME), MA0528.1 (ZNF263), CCACRYCC (DREME), MA0130.1 (ZNF354C), MA0077.1 (SOX9), UP00129 1 (Pou3f1 3819.1), MA0475.1 (FLI1), UP00043 2 (Bcl6b secondary), UP00050 1 (Bhlhb2 primary), MA0138.2 (REST), UP00005 2 (Tcfap2a secondary), MA0155.1 (INSM1), CCABCTCC (DREME), MA0080.3 (Spi1) |
Sequence Database |
Previous Next Top |
| Name | Last Modified | Loaded | Too Short | No Primary | Too Similar | Used |
|---|---|---|---|---|---|---|
| Static Sex-independent | Wed Jun 7 10:47:08 2017 | 67058 | 0 | 52969 | 3 | 14086 |
Secondary Databases |
Previous Next Top |
| Name | Last Modified | Number of Motifs | Motifs Significant | Motifs Redundant |
|---|---|---|---|---|
| meme.xml | Wed Jun 7 10:49:30 2017 | 3 | 0 | 0 |
| dreme.xml | Wed Jun 7 15:52:22 2017 | 63 | 4 | 0 |
| JASPAR CORE 2014 vertebrates | Wed Jun 7 10:46:42 2017 | 204 | 17 | 2 |
| uniprobe mouse | Wed Jun 7 10:46:42 2017 | 386 | 21 | 1 |
Spacings of "MA0139.1 (CTCF)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: MA0139.1 (CTCF) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
TGGCCACCAGGGGGCGCTA
|
0.0001 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3197Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||||||
Spacings of "UP00021 1 (Zfp281 primary)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: UP00021 1 (Zfp281 primary) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
TCCCCCCCCCCCCCC
|
0.0005 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6288Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00407 2 (Elf3 secondary)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: UP00407 2 (Elf3 secondary) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
GTTCAAAAAAAAAATTC
|
0.00064 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5412Motif Databaseuniprobe mouse |
|||||||||||||||||||||||
Spacings of "UP00077 2 (Srf secondary)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: UP00077 2 (Srf secondary) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
GTTAAAAAAAAAAATTT
|
0.022 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5914Motif Databaseuniprobe mouse |
|||||||||||||||||||||||||||
Spacings of "UP00033 2 (Zfp410 secondary)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: UP00033 2 (Zfp410 secondary) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
TCACCCCGCCCCTAATT
|
0.029 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8709Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0516.1 (SP2)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: MA0516.1 (SP2) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
GCCCCGCCCCCTCCC
|
0.038 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7900Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||||||||||
Spacings of "VGGAAR (DREME)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: VGGAAR (DREME) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
AGGAAG
|
0.076 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif11635Motif Databasedreme.xml |
|||||||||||
Spacings of "MA0528.1 (ZNF263)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: MA0528.1 (ZNF263) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
GGAGGAGGAGGGGGAGGAGGA
|
0.081 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7597Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||||||||||||||
Spacings of "CCACRYCC (DREME)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: CCACRYCC (DREME) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
CCACACCC
|
0.34 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1312Motif Databasedreme.xml |
|||||||||||
| Similar Secondary: UP00093 1 (Klf7 primary) | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7046Alignment by most significant spacings
|
|||||||||||||||||||
| Similar Secondary: MA0493.1 (Klf1) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5971Alignment by most significant spacings
|
|||||||||||||||
| Similar Secondary: MA0039.2 (Klf4) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7402Alignment by most significant spacings
|
|||||||||||||||
Spacings of "MA0130.1 (ZNF354C)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: MA0130.1 (ZNF354C) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
ATCCAC
|
0.43 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif10519Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0077.1 (SOX9)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: MA0077.1 (SOX9) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
CCATTGTTC
|
0.46 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4906Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00129 1 (Pou3f1 3819.1)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: UP00129 1 (Pou3f1 3819.1) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
AATTAATTAATTAATTC
|
0.48 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1529Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0475.1 (FLI1)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: MA0475.1 (FLI1) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
ACAGGAAGTGG
|
0.5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7092Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||||||
Spacings of "UP00043 2 (Bcl6b secondary)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: UP00043 2 (Bcl6b secondary) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
ATCCCCGCCCCTAAAA
|
0.83 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8829Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00050 1 (Bhlhb2 primary)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: UP00050 1 (Bhlhb2 primary) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
GGAAGAGTCACGTGACCAATAC
|
0.87 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1895Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "MA0138.2 (REST)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: MA0138.2 (REST) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
TTCAGCACCATGGACAGCGCC
|
0.91 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif746Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00005 2 (Tcfap2a secondary)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: UP00005 2 (Tcfap2a secondary) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
TCACCTCTGGGCAG
|
1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8431Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0155.1 (INSM1)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: MA0155.1 (INSM1) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
TGTCAGGGGGCG
|
1.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2666Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "CCABCTCC (DREME)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: CCABCTCC (DREME) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
CCACCTCC
|
1.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1477Motif Databasedreme.xml |
|||||||||||
Spacings of "MA0080.3 (Spi1)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: MA0080.3 (Spi1) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
AAAAAGAGGAAGTGA
|
1.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6787Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0465.1 (CDX2)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: MA0465.1 (CDX2) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
AAGCCATAAAA
|
1.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1063Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0494.1 (Nr1h3::Rxra)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: MA0494.1 (Nr1h3::Rxra) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
TGACCTAAAGTAACCTCTG
|
1.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3516Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00064 2 (Sox18 secondary)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: UP00064 2 (Sox18 secondary) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
GGACTGAATTCATGCC
|
1.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2285Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00029 1 (Tbp primary)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: UP00029 1 (Tbp primary) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
TCTTTATATATAAATA
|
1.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2803Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "STGGCCA (DREME)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: STGGCCA (DREME) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
CTGGCCA
|
1.9 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1797Motif Databasedreme.xml |
|||||||||||
Spacings of "UP00180 1 (Hoxd13 2356.1)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: UP00180 1 (Hoxd13 2356.1) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
CTACCAATAAAATTCT
|
2.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3440Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0079.3 (SP1)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: MA0079.3 (SP1) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
GCCCCGCCCCC
|
2.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7757Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||||||||||
Spacings of "UP00077 1 (Srf primary)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: UP00077 1 (Srf primary) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
TTCCATATATGGAA
|
2.9 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2587Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00097 2 (Mtf1 secondary)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: UP00097 2 (Mtf1 secondary) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
AAATAAGAAAAAAC
|
3.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4473Motif Databaseuniprobe mouse |
|||||||||||||||||||||||
Spacings of "UP00005 1 (Tcfap2a primary)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: UP00005 1 (Tcfap2a primary) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
ATTCCCTGAGGGGAA
|
3.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6430Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00057 1 (Zic2 primary)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: UP00057 1 (Zic2 primary) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
CCCCCCCGGGGGGGT
|
3.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3781Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0599.1 (KLF5)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: MA0599.1 (KLF5) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
GCCCCGCCCC
|
3.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7530Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||||||
Spacings of "UP00059 1 (Arid5a primary)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: UP00059 1 (Arid5a primary) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
CTAATATTGCTAAA
|
4.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2401Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0059.1 (MYC::MAX)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: MA0059.1 (MYC::MAX) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
GACCACGTGGT
|
5.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1913Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0068.1 (Pax4)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: MA0068.1 (Pax4) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
GAAAAATTTCCCATACTCCACTCCCCCCCC
|
5.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4828Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0081.1 (SPIB)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: MA0081.1 (SPIB) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
AGAGGAA
|
5.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8970Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00006 1 (Zic3 primary)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: UP00006 1 (Zic3 primary) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
CCCCCCCGGGGGGGT
|
6.6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4594Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00048 1 (Rara primary)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: UP00048 1 (Rara primary) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
TCTCAAAGGTCACCTG
|
6.6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4687Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00043 1 (Bcl6b primary)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: UP00043 1 (Bcl6b primary) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
TCTTTCGAGGAATTTG
|
7.6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3999Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00254 1 (Pou2f1 3081.2)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: UP00254 1 (Pou2f1 3081.2) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
ATGTATTAATTAAGTA
|
8.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2544Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0065.2 (PPARG::RXRA)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: MA0065.2 (PPARG::RXRA) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
GTAGGGCAAAGGTCA
|
9.6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8415Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||
Spacings of "UP00062 1 (Sox4 primary)" relative to "MA0062.2 (GABPA)" |
Previous Next Top |
| Primary: MA0062.2 (GABPA) | Secondary: UP00062 1 (Sox4 primary) | E-value |
|---|---|---|
|
CCGGAAGTGGC
|
AGAAGAACAAAGGACTA
|
9.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4841Motif Databaseuniprobe mouse |
|||||||||||||||