The name of the primary motif.
The logo of the primary motif.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The number of secondary motifs found that had significant spacings in the tested region.
The list of secondary motifs found that had significant spacings in the tested region.
The name of the sequence database.
The last modified date of the sequence database.
The number of sequences in the sequence database.
The number of sequences in the sequence database which were excluded because they were shorter than twice the margin plus the primary motif length.
The number of sequences in the sequence database which were excluded because no match to the primary motif could be found at a distance to the edges larger than the margin.
The number of sequences in the sequence database which were excluded because they were largly identical to other sequences when aligned on the primary motif site.
The number of sequences which were scanned with the secondary motifs.
The name of the motif database derived from the file name.
The date that the motif database was last modified.
The number of motifs loaded from the motif database. Some motifs may have been excluded.
The number of motifs with significant E-values whose significant spacings were not considered too similar to those of another motif.
The number of motifs that while having significant spacings were less signficant than another motif that matched most of the same sites.
The primary motif is used as the reference point for all spacing calculation.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The secondary motif occurs at the spacings relative to the primary shown in the histogram below.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The E-value is the lowest p-value of any spacing of the secondary motif times the number of secondary motifs. It estimates the expected number of random secondary motifs that would have the observed minimum p-value or less.
The histogram below shows the frequency of spacings from the primary motif to the secondary motif. Red bars indicate that a spacing has occured a statistically significant number of times.
The details of the significant spacings are shown in the four quadrants as they relate to the quadrants of the graph.
The total number of sequences that have a match for both the primary motif and this secondary motif.
The motif database which this secondary motif came from.
The list of secondary motifs which have been identified as possibly similar to this motif because their most significant spacings overlaped with the most significant spacing of this motif. Check the boxes to show the possibly similar secondary motifs.
This shows the first secondary motif aligned with the current secondary motif by the most significant spacing.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
For further information on how to interpret these results or to get a copy of the MEME software please access http://meme.nbcr.net.
If you use SpaMo in your research please cite the following paper:
Tom Whitington, Martin C. Frith, James Johnson and Timothy L. Bailey,
"Inferring transcription factor complexes from ChIP-seq data",
Nucleic Acids Research, 39(15):e98, 2011.
[full text]
Primary Motif |
Next Top |
| Name | Preview | Significant Secondaries | List |
|---|---|---|---|
| UP00060 2 (Max secondary) |
GTGCCACGCGACTG
|
35 | UP00153 1 (Pitx1 2312.1), UP00231 1 (Nkx2-2 2823.1), UP00255 1 (Dbx1 3486.1), CCBGCCTC (DREME), AGGCDGAG (DREME), UP00244 1 (Tlx2 3498.2), MA0442.1 (SOX10), UP00096 1 (Sox13 primary), UP00097 2 (Mtf1 secondary), MA0062.2 (GABPA), MA0155.1 (INSM1), UP00166 1 (Barhl1 2590.2), MA0122.1 (Nkx3-2), UP00407 2 (Elf3 secondary), UP00221 1 (Phox2a 3947.1), UP00077 2 (Srf secondary), MA0497.1 (MEF2C), UP00093 1 (Klf7 primary), 1 (MEME), MA0108.2 (TBP) |
Sequence Database |
Previous Next Top |
| Name | Last Modified | Loaded | Too Short | No Primary | Too Similar | Used |
|---|---|---|---|---|---|---|
| Static Sex-independent | Wed Jun 7 10:47:08 2017 | 67058 | 0 | 50095 | 3 | 16960 |
Secondary Databases |
Previous Next Top |
| Name | Last Modified | Number of Motifs | Motifs Significant | Motifs Redundant |
|---|---|---|---|---|
| meme.xml | Wed Jun 7 10:49:30 2017 | 3 | 2 | 0 |
| dreme.xml | Wed Jun 7 15:52:22 2017 | 63 | 5 | 3 |
| JASPAR CORE 2014 vertebrates | Wed Jun 7 10:46:42 2017 | 205 | 7 | 3 |
| uniprobe mouse | Wed Jun 7 10:46:42 2017 | 385 | 21 | 10 |
Spacings of "UP00153 1 (Pitx1 2312.1)" relative to "UP00060 2 (Max secondary)" |
Previous Next Top |
| Primary: UP00060 2 (Max secondary) | Secondary: UP00153 1 (Pitx1 2312.1) | E-value |
|---|---|---|
|
GTGCCACGCGACTG
|
TTAGAGGGATTAACAAT
|
6.3e-15 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2588Motif Databaseuniprobe mouse |
|||||||||||
| Similar Secondary: UP00109 1 (Obox6 3440.2) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1584Alignment by most significant spacings
|
|||||||||||||||
| Similar Secondary: UP00089 2 (Tcf1 secondary) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4213Alignment by most significant spacings
|
|||||||||||||||
| Similar Secondary: UP00125 1 (Pitx2 2274.3) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2979Alignment by most significant spacings
|
|||||||||||||||
| Similar Secondary: UP00216 1 (Obox1 3970.2) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1615Alignment by most significant spacings
|
|||||||||||||||
| Similar Secondary: UP00111 1 (Dmbx1 2277.1) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2162Alignment by most significant spacings
|
|||||||||||||||
| Similar Secondary: UP00267 1 (Otx2 3441.1) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2541Alignment by most significant spacings
|
|||||||||||||||
| Similar Secondary: MA0151.1 (ARID3A) | |||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5597Alignment by most significant spacings
|
|||||||||||||||||||||||
| Similar Secondary: TTTAWW (DREME) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5370Alignment by most significant spacings
|
|||||||||||||||
| Similar Secondary: CHGGRA (DREME) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif14022Alignment by most significant spacings
|
|||||||||||||||
| Similar Secondary: MA0483.1 (Gfi1b) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4269Alignment by most significant spacings
|
|||||||||||||||
Spacings of "UP00231 1 (Nkx2-2 2823.1)" relative to "UP00060 2 (Max secondary)" |
Previous Next Top |
| Primary: UP00060 2 (Max secondary) | Secondary: UP00231 1 (Nkx2-2 2823.1) | E-value |
|---|---|---|
|
GTGCCACGCGACTG
|
TTAACCACTTGAAAATT
|
0.00065 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3643Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00255 1 (Dbx1 3486.1)" relative to "UP00060 2 (Max secondary)" |
Previous Next Top |
| Primary: UP00060 2 (Max secondary) | Secondary: UP00255 1 (Dbx1 3486.1) | E-value |
|---|---|---|
|
GTGCCACGCGACTG
|
TAATTAATTAATAATTA
|
0.001 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5061Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "CCBGCCTC (DREME)" relative to "UP00060 2 (Max secondary)" |
Previous Next Top |
| Primary: UP00060 2 (Max secondary) | Secondary: CCBGCCTC (DREME) | E-value |
|---|---|---|
|
GTGCCACGCGACTG
|
CCTGCCTC
|
0.007 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1922Motif Databasedreme.xml |
|||||||||||
Spacings of "AGGCDGAG (DREME)" relative to "UP00060 2 (Max secondary)" |
Previous Next Top |
| Primary: UP00060 2 (Max secondary) | Secondary: AGGCDGAG (DREME) | E-value |
|---|---|---|
|
GTGCCACGCGACTG
|
AGGCTGAG
|
0.0073 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1927Motif Databasedreme.xml |
|||||||||||||||||||
| Similar Secondary: CYGCCDCC (DREME) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3457Alignment by most significant spacings
|
|||||||||||||||
Spacings of "UP00244 1 (Tlx2 3498.2)" relative to "UP00060 2 (Max secondary)" |
Previous Next Top |
| Primary: UP00060 2 (Max secondary) | Secondary: UP00244 1 (Tlx2 3498.2) | E-value |
|---|---|---|
|
GTGCCACGCGACTG
|
TAATTAATTAATAACTT
|
0.014 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3854Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "MA0442.1 (SOX10)" relative to "UP00060 2 (Max secondary)" |
Previous Next Top |
| Primary: UP00060 2 (Max secondary) | Secondary: MA0442.1 (SOX10) | E-value |
|---|---|---|
|
GTGCCACGCGACTG
|
CTTTGT
|
0.042 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif13617Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00096 1 (Sox13 primary)" relative to "UP00060 2 (Max secondary)" |
Previous Next Top |
| Primary: UP00060 2 (Max secondary) | Secondary: UP00096 1 (Sox13 primary) | E-value |
|---|---|---|
|
GTGCCACGCGACTG
|
TTAAGAACAATAATTT
|
0.32 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4649Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00097 2 (Mtf1 secondary)" relative to "UP00060 2 (Max secondary)" |
Previous Next Top |
| Primary: UP00060 2 (Max secondary) | Secondary: UP00097 2 (Mtf1 secondary) | E-value |
|---|---|---|
|
GTGCCACGCGACTG
|
AAATAAGAAAAAAC
|
0.6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5265Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0062.2 (GABPA)" relative to "UP00060 2 (Max secondary)" |
Previous Next Top |
| Primary: UP00060 2 (Max secondary) | Secondary: MA0062.2 (GABPA) | E-value |
|---|---|---|
|
GTGCCACGCGACTG
|
CCGGAAGTGGC
|
0.72 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4999Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
| Similar Secondary: MA0473.1 (ELF1) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6366Alignment by most significant spacings
|
|||||||||||||||
Spacings of "MA0155.1 (INSM1)" relative to "UP00060 2 (Max secondary)" |
Previous Next Top |
| Primary: UP00060 2 (Max secondary) | Secondary: MA0155.1 (INSM1) | E-value |
|---|---|---|
|
GTGCCACGCGACTG
|
TGTCAGGGGGCG
|
0.75 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3138Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
| Similar Secondary: UP00018 1 (Irf4 primary) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2705Alignment by most significant spacings
|
|||||||||||||||
Spacings of "UP00166 1 (Barhl1 2590.2)" relative to "UP00060 2 (Max secondary)" |
Previous Next Top |
| Primary: UP00060 2 (Max secondary) | Secondary: UP00166 1 (Barhl1 2590.2) | E-value |
|---|---|---|
|
GTGCCACGCGACTG
|
AACAACCAATTAATTC
|
0.83 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2613Motif Databaseuniprobe mouse |
|||||||||||
| Similar Secondary: UP00171 1 (Msx3 3206.1) | |||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2020Alignment by most significant spacings
|
|||||||||||||||||||||||
Spacings of "MA0122.1 (Nkx3-2)" relative to "UP00060 2 (Max secondary)" |
Previous Next Top |
| Primary: UP00060 2 (Max secondary) | Secondary: MA0122.1 (Nkx3-2) | E-value |
|---|---|---|
|
GTGCCACGCGACTG
|
TTAAGTGGA
|
0.98 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif11565Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00407 2 (Elf3 secondary)" relative to "UP00060 2 (Max secondary)" |
Previous Next Top |
| Primary: UP00060 2 (Max secondary) | Secondary: UP00407 2 (Elf3 secondary) | E-value |
|---|---|---|
|
GTGCCACGCGACTG
|
GTTCAAAAAAAAAATTC
|
1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6484Motif Databaseuniprobe mouse |
|||||||||||||||||||||||||||
Spacings of "UP00221 1 (Phox2a 3947.1)" relative to "UP00060 2 (Max secondary)" |
Previous Next Top |
| Primary: UP00060 2 (Max secondary) | Secondary: UP00221 1 (Phox2a 3947.1) | E-value |
|---|---|---|
|
GTGCCACGCGACTG
|
CAGCATTAATTAGTAG
|
1.3 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1702Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00077 2 (Srf secondary)" relative to "UP00060 2 (Max secondary)" |
Previous Next Top |
| Primary: UP00060 2 (Max secondary) | Secondary: UP00077 2 (Srf secondary) | E-value |
|---|---|---|
|
GTGCCACGCGACTG
|
GTTAAAAAAAAAAATTT
|
1.3 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6842Motif Databaseuniprobe mouse |
|||||||||||||||||||||||||||
Spacings of "MA0497.1 (MEF2C)" relative to "UP00060 2 (Max secondary)" |
Previous Next Top |
| Primary: UP00060 2 (Max secondary) | Secondary: MA0497.1 (MEF2C) | E-value |
|---|---|---|
|
GTGCCACGCGACTG
|
ATGCTAAAAATAGAA
|
1.5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3867Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00093 1 (Klf7 primary)" relative to "UP00060 2 (Max secondary)" |
Previous Next Top |
| Primary: UP00060 2 (Max secondary) | Secondary: UP00093 1 (Klf7 primary) | E-value |
|---|---|---|
|
GTGCCACGCGACTG
|
TCGACCCCGCCCCTAT
|
2.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8008Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "1 (MEME)" relative to "UP00060 2 (Max secondary)" |
Previous Next Top |
| Primary: UP00060 2 (Max secondary) | Secondary: 1 (MEME) | E-value |
|---|---|---|
|
GTGCCACGCGACTG
|
CCCGCGCCCCCTCCCGCCCCGCCTCCGCC
|
2.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5562Motif Databasememe.xml |
|||||||||||
Spacings of "MA0108.2 (TBP)" relative to "UP00060 2 (Max secondary)" |
Previous Next Top |
| Primary: UP00060 2 (Max secondary) | Secondary: MA0108.2 (TBP) | E-value |
|---|---|---|
|
GTGCCACGCGACTG
|
GTATAAAAGGCGGGG
|
3.6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4856Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "CAGGMTG (DREME)" relative to "UP00060 2 (Max secondary)" |
Previous Next Top |
| Primary: UP00060 2 (Max secondary) | Secondary: CAGGMTG (DREME) | E-value |
|---|---|---|
|
GTGCCACGCGACTG
|
CAGGCTG
|
3.9 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3634Motif Databasedreme.xml |
|||||||||||||||||||
Spacings of "UP00057 2 (Zic2 secondary)" relative to "UP00060 2 (Max secondary)" |
Previous Next Top |
| Primary: UP00060 2 (Max secondary) | Secondary: UP00057 2 (Zic2 secondary) | E-value |
|---|---|---|
|
GTGCCACGCGACTG
|
CCACACAGCAGGAGA
|
3.9 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8261Motif Databaseuniprobe mouse |
|||||||||||
| Similar Secondary: UP00102 2 (Zic1 secondary) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8342Alignment by most significant spacings
|
|||||||||||||||
| Similar Secondary: UP00006 2 (Zic3 secondary) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8278Alignment by most significant spacings
|
|||||||||||||||
Spacings of "MA0068.1 (Pax4)" relative to "UP00060 2 (Max secondary)" |
Previous Next Top |
| Primary: UP00060 2 (Max secondary) | Secondary: MA0068.1 (Pax4) | E-value |
|---|---|---|
|
GTGCCACGCGACTG
|
GAAAAATTTCCCATACTCCACTCCCCCCCC
|
3.9 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5624Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "CTGGGYW (DREME)" relative to "UP00060 2 (Max secondary)" |
Previous Next Top |
| Primary: UP00060 2 (Max secondary) | Secondary: CTGGGYW (DREME) | E-value |
|---|---|---|
|
GTGCCACGCGACTG
|
CTGGGCT
|
4.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5266Motif Databasedreme.xml |
|||||||||||
Spacings of "UP00130 1 (Lhx3 3431.1)" relative to "UP00060 2 (Max secondary)" |
Previous Next Top |
| Primary: UP00060 2 (Max secondary) | Secondary: UP00130 1 (Lhx3 3431.1) | E-value |
|---|---|---|
|
GTGCCACGCGACTG
|
GTAATTAATTAAATAAT
|
4.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1383Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00208 1 (Obox5 2284.1)" relative to "UP00060 2 (Max secondary)" |
Previous Next Top |
| Primary: UP00060 2 (Max secondary) | Secondary: UP00208 1 (Obox5 2284.1) | E-value |
|---|---|---|
|
GTGCCACGCGACTG
|
TAGAGGGATTAAATTTC
|
4.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1647Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00016 1 (Sry primary)" relative to "UP00060 2 (Max secondary)" |
Previous Next Top |
| Primary: UP00060 2 (Max secondary) | Secondary: UP00016 1 (Sry primary) | E-value |
|---|---|---|
|
GTGCCACGCGACTG
|
TATAATTATAATATTC
|
4.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1200Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00094 2 (Zfp128 secondary)" relative to "UP00060 2 (Max secondary)" |
Previous Next Top |
| Primary: UP00060 2 (Max secondary) | Secondary: UP00094 2 (Zfp128 secondary) | E-value |
|---|---|---|
|
GTGCCACGCGACTG
|
TGTATATATATACC
|
5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3303Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00209 2 (Cart1 1275.1)" relative to "UP00060 2 (Max secondary)" |
Previous Next Top |
| Primary: UP00060 2 (Max secondary) | Secondary: UP00209 2 (Cart1 1275.1) | E-value |
|---|---|---|
|
GTGCCACGCGACTG
|
CGCATTAATTAATTGGC
|
5.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1449Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "AGRDGGCG (DREME)" relative to "UP00060 2 (Max secondary)" |
Previous Next Top |
| Primary: UP00060 2 (Max secondary) | Secondary: AGRDGGCG (DREME) | E-value |
|---|---|---|
|
GTGCCACGCGACTG
|
AGGGGGCG
|
5.3 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1958Motif Databasedreme.xml |
|||||||||||
Spacings of "UP00028 2 (Tcfap2e secondary)" relative to "UP00060 2 (Max secondary)" |
Previous Next Top |
| Primary: UP00060 2 (Max secondary) | Secondary: UP00028 2 (Tcfap2e secondary) | E-value |
|---|---|---|
|
GTGCCACGCGACTG
|
TACTGGAAAAAAAA
|
5.6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7690Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00099 2 (Ascl2 secondary)" relative to "UP00060 2 (Max secondary)" |
Previous Next Top |
| Primary: UP00060 2 (Max secondary) | Secondary: UP00099 2 (Ascl2 secondary) | E-value |
|---|---|---|
|
GTGCCACGCGACTG
|
CTATCCCCGCCCTATT
|
5.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8911Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00081 2 (Mybl1 secondary)" relative to "UP00060 2 (Max secondary)" |
Previous Next Top |
| Primary: UP00060 2 (Max secondary) | Secondary: UP00081 2 (Mybl1 secondary) | E-value |
|---|---|---|
|
GTGCCACGCGACTG
|
CGACCAACTGCCGTG
|
7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4674Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00029 1 (Tbp primary)" relative to "UP00060 2 (Max secondary)" |
Previous Next Top |
| Primary: UP00060 2 (Max secondary) | Secondary: UP00029 1 (Tbp primary) | E-value |
|---|---|---|
|
GTGCCACGCGACTG
|
TCTTTATATATAAATA
|
7.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3439Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "2 (MEME)" relative to "UP00060 2 (Max secondary)" |
Previous Next Top |
| Primary: UP00060 2 (Max secondary) | Secondary: 2 (MEME) | E-value |
|---|---|---|
|
GTGCCACGCGACTG
|
GTGTGTGTGTG
|
7.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3723Motif Databasememe.xml |
|||||||||||