The name of the primary motif.
The logo of the primary motif.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The number of secondary motifs found that had significant spacings in the tested region.
The list of secondary motifs found that had significant spacings in the tested region.
The name of the sequence database.
The last modified date of the sequence database.
The number of sequences in the sequence database.
The number of sequences in the sequence database which were excluded because they were shorter than twice the margin plus the primary motif length.
The number of sequences in the sequence database which were excluded because no match to the primary motif could be found at a distance to the edges larger than the margin.
The number of sequences in the sequence database which were excluded because they were largly identical to other sequences when aligned on the primary motif site.
The number of sequences which were scanned with the secondary motifs.
The name of the motif database derived from the file name.
The date that the motif database was last modified.
The number of motifs loaded from the motif database. Some motifs may have been excluded.
The number of motifs with significant E-values whose significant spacings were not considered too similar to those of another motif.
The number of motifs that while having significant spacings were less signficant than another motif that matched most of the same sites.
The primary motif is used as the reference point for all spacing calculation.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The secondary motif occurs at the spacings relative to the primary shown in the histogram below.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The E-value is the lowest p-value of any spacing of the secondary motif times the number of secondary motifs. It estimates the expected number of random secondary motifs that would have the observed minimum p-value or less.
The histogram below shows the frequency of spacings from the primary motif to the secondary motif. Red bars indicate that a spacing has occured a statistically significant number of times.
The details of the significant spacings are shown in the four quadrants as they relate to the quadrants of the graph.
The total number of sequences that have a match for both the primary motif and this secondary motif.
The motif database which this secondary motif came from.
The list of secondary motifs which have been identified as possibly similar to this motif because their most significant spacings overlaped with the most significant spacing of this motif. Check the boxes to show the possibly similar secondary motifs.
This shows the first secondary motif aligned with the current secondary motif by the most significant spacing.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
For further information on how to interpret these results or to get a copy of the MEME software please access http://meme.nbcr.net.
If you use SpaMo in your research please cite the following paper:
Tom Whitington, Martin C. Frith, James Johnson and Timothy L. Bailey,
"Inferring transcription factor complexes from ChIP-seq data",
Nucleic Acids Research, 39(15):e98, 2011.
[full text]
Primary Motif |
Next Top |
| Name | Preview | Significant Secondaries | List |
|---|---|---|---|
| UP00009 2 (Nr2f2 secondary) |
CGCGCCGGGTCACGTA
|
59 | MA0160.1 (NR4A2), UP00053 1 (Rxra primary), AGGHCA (DREME), RAGKTCA (DREME), MA0258.2 (ESR2), MA0059.1 (MYC::MAX), MA0159.1 (RXR::RAR DR5), UP00066 1 (Hnf4a primary), CTGAGYCA (DREME), CTGGGYW (DREME), MA0478.1 (FOSL2), MA0112.2 (ESR1), UP00022 1 (Zfp740 primary), UP00153 1 (Pitx1 2312.1), UP00079 1 (Esrra primary), UP00052 2 (Osr2 secondary), MA0161.1 (NFIC), MA0007.2 (AR), UP00048 1 (Rara primary), UP00095 2 (Zfp691 secondary) |
Sequence Database |
Previous Next Top |
| Name | Last Modified | Loaded | Too Short | No Primary | Too Similar | Used |
|---|---|---|---|---|---|---|
| Static Sex-independent | Wed Jun 7 10:47:08 2017 | 67058 | 0 | 52832 | 3 | 14223 |
Secondary Databases |
Previous Next Top |
| Name | Last Modified | Number of Motifs | Motifs Significant | Motifs Redundant |
|---|---|---|---|---|
| meme.xml | Wed Jun 7 10:49:30 2017 | 3 | 0 | 0 |
| dreme.xml | Wed Jun 7 15:52:22 2017 | 63 | 5 | 0 |
| JASPAR CORE 2014 vertebrates | Wed Jun 7 10:46:42 2017 | 205 | 21 | 1 |
| uniprobe mouse | Wed Jun 7 10:46:42 2017 | 385 | 33 | 2 |
Spacings of "MA0160.1 (NR4A2)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: MA0160.1 (NR4A2) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
AAGGTCAC
|
2.3e-75 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif9246Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00053 1 (Rxra primary)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: UP00053 1 (Rxra primary) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
TGTCGTGACCCCTTAAT
|
1.7e-55 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5645Motif Databaseuniprobe mouse |
|||||||||||||||||||||||
Spacings of "AGGHCA (DREME)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: AGGHCA (DREME) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
AGGCCA
|
4.6e-48 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8697Motif Databasedreme.xml |
|||||||||||||||
Spacings of "RAGKTCA (DREME)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: RAGKTCA (DREME) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
AAGGTCA
|
9.2e-43 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3833Motif Databasedreme.xml |
|||||||||||||||
Spacings of "MA0258.2 (ESR2)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: MA0258.2 (ESR2) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
AGGTCACCCTGACCT
|
1.8e-07 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5385Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0059.1 (MYC::MAX)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: MA0059.1 (MYC::MAX) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
GACCACGTGGT
|
9.9e-05 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2009Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
| Similar Secondary: MA0526.1 (USF2) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3009Alignment by most significant spacings
|
|||||||||||||||
Spacings of "MA0159.1 (RXR::RAR DR5)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: MA0159.1 (RXR::RAR DR5) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
AGGTCACGGAGAGGTCA
|
0.00074 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2600Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00066 1 (Hnf4a primary)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: UP00066 1 (Hnf4a primary) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
CTTCAGGGGTCAATTGA
|
0.0011 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4898Motif Databaseuniprobe mouse |
|||||||||||||||
Spacings of "CTGAGYCA (DREME)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: CTGAGYCA (DREME) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
CTGAGTCA
|
0.0015 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif979Motif Databasedreme.xml |
|||||||||||
Spacings of "CTGGGYW (DREME)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: CTGGGYW (DREME) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
CTGGGCT
|
0.002 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4531Motif Databasedreme.xml |
|||||||||||
Spacings of "MA0478.1 (FOSL2)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: MA0478.1 (FOSL2) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
GGATGACTCAT
|
0.0055 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2088Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0112.2 (ESR1)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: MA0112.2 (ESR1) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
GGCCCAGGTCACCCTGACCT
|
0.0072 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5366Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||
Spacings of "UP00022 1 (Zfp740 primary)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: UP00022 1 (Zfp740 primary) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
CCCCCCCCCCCACTTG
|
0.0074 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5338Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00153 1 (Pitx1 2312.1)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: UP00153 1 (Pitx1 2312.1) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
TTAGAGGGATTAACAAT
|
0.0079 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2369Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00079 1 (Esrra primary)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: UP00079 1 (Esrra primary) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
TATTCAAGGTCATGCGA
|
0.009 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4510Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00052 2 (Osr2 secondary)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: UP00052 2 (Osr2 secondary) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
ACTTGCTACCTACACC
|
0.01 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6209Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0161.1 (NFIC)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: MA0161.1 (NFIC) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
TTGGCA
|
0.016 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif12548Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||||||
Spacings of "MA0007.2 (AR)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: MA0007.2 (AR) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
AAGAACAGAATGTTC
|
0.041 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4666Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00048 1 (Rara primary)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: UP00048 1 (Rara primary) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
TCTCAAAGGTCACCTG
|
0.055 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5240Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00095 2 (Zfp691 secondary)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: UP00095 2 (Zfp691 secondary) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
TACGAGACTCCTCTAAC
|
0.09 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7057Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0004.1 (Arnt)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: MA0004.1 (Arnt) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
CACGTG
|
0.11 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2357Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00071 1 (Sox21 primary)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: UP00071 1 (Sox21 primary) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
TTTAATTATAATTAAG
|
0.15 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3147Motif Databaseuniprobe mouse |
|||||||||||
| Similar Secondary: UP00004 1 (Sox14 primary) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2534Alignment by most significant spacings
|
|||||||||||||||
Spacings of "MA0108.2 (TBP)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: MA0108.2 (TBP) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
GTATAAAAGGCGGGG
|
0.15 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4320Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00029 1 (Tbp primary)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: UP00029 1 (Tbp primary) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
TCTTTATATATAAATA
|
0.17 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3150Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "UP00099 1 (Ascl2 primary)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: UP00099 1 (Ascl2 primary) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
CTCAGCAGCTGCTCCTG
|
0.28 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7279Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00021 1 (Zfp281 primary)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: UP00021 1 (Zfp281 primary) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
TCCCCCCCCCCCCCC
|
0.28 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5849Motif Databaseuniprobe mouse |
|||||||||||||||
Spacings of "UP00021 2 (Zfp281 secondary)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: UP00021 2 (Zfp281 secondary) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
AGGAGACCCCCAATTTG
|
0.31 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2915Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0067.1 (Pax2)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: MA0067.1 (Pax2) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
AGTCACGC
|
0.37 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6506Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00407 2 (Elf3 secondary)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: UP00407 2 (Elf3 secondary) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
GTTCAAAAAAAAAATTC
|
0.41 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5879Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00188 1 (Lmx1a 2238.2)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: UP00188 1 (Lmx1a 2238.2) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
CGAATTAATTAAAAACC
|
0.53 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2226Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "MA0089.1 (NFE2L1::MafG)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: MA0089.1 (NFE2L1::MafG) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
CATGAC
|
0.94 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7256Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00151 1 (Barx2 3447.2)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: UP00151 1 (Barx2 3447.2) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
TAAGTAATTAGTTATA
|
1.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2140Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0504.1 (NR2C2)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: MA0504.1 (NR2C2) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
AGGGGTCAGAGGTCA
|
1.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4073Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00023 2 (Sox30 secondary)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: UP00023 2 (Sox30 secondary) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
TAAGATTATAATACGG
|
1.3 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2970Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00028 1 (Tcfap2e primary)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: UP00028 1 (Tcfap2e primary) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
ATTGCCTGAGGCGAT
|
1.5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4818Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0071.1 (RORA 1)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: MA0071.1 (RORA 1) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
ATCAAGGTCA
|
1.9 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3392Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00060 1 (Max primary)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: UP00060 1 (Max primary) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
TGACCACGTGGTCGGG
|
2.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2844Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "MA0494.1 (Nr1h3::Rxra)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: MA0494.1 (Nr1h3::Rxra) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
TGACCTAAAGTAACCTCTG
|
2.5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3895Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||||||
Spacings of "MA0516.1 (SP2)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: MA0516.1 (SP2) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
GCCCCGCCCCCTCCC
|
3.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7072Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00005 1 (Tcfap2a primary)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: UP00005 1 (Tcfap2a primary) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
ATTCCCTGAGGGGAA
|
3.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6046Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "UP00027 2 (Osr1 secondary)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: UP00027 2 (Osr1 secondary) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
ACATGCTACCTAATAC
|
3.3 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7584Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0109.1 (Hltf)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: MA0109.1 (Hltf) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
AACCTTATAT
|
4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif11547Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0027.1 (En1)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: MA0027.1 (En1) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
AAGTAGTGCCC
|
4.3 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6576Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00219 1 (Cutl1 3494.1)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: UP00219 1 (Cutl1 3494.1) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
ACCGGTTGATCACCTGA
|
4.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3500Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00031 2 (Zbtb3 secondary)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: UP00031 2 (Zbtb3 secondary) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
CAATCACTGGCAGAAT
|
4.5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8206Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00164 1 (Hoxa7 2668.2)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: UP00164 1 (Hoxa7 2668.2) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
CGAGTTAATTAATAAGC
|
4.9 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3573Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00172 1 (Prop1 3949.1)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: UP00172 1 (Prop1 3949.1) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
CGAATTAATTAAGAAAC
|
4.9 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1394Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00096 1 (Sox13 primary)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: UP00096 1 (Sox13 primary) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
TTAAGAACAATAATTT
|
5.3 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4182Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00006 2 (Zic3 secondary)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: UP00006 2 (Zic3 secondary) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
GAGCACAGCAGGACA
|
5.5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6968Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00024 2 (Glis2 secondary)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: UP00024 2 (Glis2 secondary) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
AATATTAATAAAGA
|
5.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4609Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00009 1 (Nr2f2 primary)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: UP00009 1 (Nr2f2 primary) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
TCTCAAAGGTCACGAG
|
5.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5678Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "UP00222 1 (Tcf2 0913.2)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: UP00222 1 (Tcf2 0913.2) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
AGCTGTTAACTAGCCGT
|
6.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1924Motif Databaseuniprobe mouse |
|||||||||||
| Similar Secondary: UP00113 1 (Hoxc4 3491.1) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1701Alignment by most significant spacings
|
|||||||||||||||
Spacings of "UP00007 1 (Egr1 primary)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: UP00007 1 (Egr1 primary) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
TCCGCCCCCGCATT
|
6.5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4297Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0162.2 (EGR1)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: MA0162.2 (EGR1) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
CCCCCGCCCCCGCC
|
6.6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5916Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||||||
Spacings of "ARAGGGCA (DREME)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: ARAGGGCA (DREME) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
AGAGGGCA
|
6.9 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif818Motif Databasedreme.xml |
|||||||||||
Spacings of "MA0019.1 (Ddit3::Cebpa)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: MA0019.1 (Ddit3::Cebpa) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
AGATGCAATCCC
|
7.3 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3728Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0141.2 (Esrrb)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: MA0141.2 (Esrrb) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
AGCTCAAGGTCA
|
7.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5742Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00085 1 (Sfpi1 primary)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: UP00085 1 (Sfpi1 primary) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
TTAAGAGGAAGTTA
|
8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7835Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00035 2 (Hic1 secondary)" relative to "UP00009 2 (Nr2f2 secondary)" |
Previous Next Top |
| Primary: UP00009 2 (Nr2f2 secondary) | Secondary: UP00035 2 (Hic1 secondary) | E-value |
|---|---|---|
|
CGCGCCGGGTCACGTA
|
GGGTGTGCCCAAAAGG
|
8.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5828Motif Databaseuniprobe mouse |
|||||||||||