The name of the primary motif.
The logo of the primary motif.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The number of secondary motifs found that had significant spacings in the tested region.
The list of secondary motifs found that had significant spacings in the tested region.
The name of the sequence database.
The last modified date of the sequence database.
The number of sequences in the sequence database.
The number of sequences in the sequence database which were excluded because they were shorter than twice the margin plus the primary motif length.
The number of sequences in the sequence database which were excluded because no match to the primary motif could be found at a distance to the edges larger than the margin.
The number of sequences in the sequence database which were excluded because they were largly identical to other sequences when aligned on the primary motif site.
The number of sequences which were scanned with the secondary motifs.
The name of the motif database derived from the file name.
The date that the motif database was last modified.
The number of motifs loaded from the motif database. Some motifs may have been excluded.
The number of motifs with significant E-values whose significant spacings were not considered too similar to those of another motif.
The number of motifs that while having significant spacings were less signficant than another motif that matched most of the same sites.
The primary motif is used as the reference point for all spacing calculation.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The secondary motif occurs at the spacings relative to the primary shown in the histogram below.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The E-value is the lowest p-value of any spacing of the secondary motif times the number of secondary motifs. It estimates the expected number of random secondary motifs that would have the observed minimum p-value or less.
The histogram below shows the frequency of spacings from the primary motif to the secondary motif. Red bars indicate that a spacing has occured a statistically significant number of times.
The details of the significant spacings are shown in the four quadrants as they relate to the quadrants of the graph.
The total number of sequences that have a match for both the primary motif and this secondary motif.
The motif database which this secondary motif came from.
The list of secondary motifs which have been identified as possibly similar to this motif because their most significant spacings overlaped with the most significant spacing of this motif. Check the boxes to show the possibly similar secondary motifs.
This shows the first secondary motif aligned with the current secondary motif by the most significant spacing.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
For further information on how to interpret these results or to get a copy of the MEME software please access http://meme.nbcr.net.
If you use SpaMo in your research please cite the following paper:
Tom Whitington, Martin C. Frith, James Johnson and Timothy L. Bailey,
"Inferring transcription factor complexes from ChIP-seq data",
Nucleic Acids Research, 39(15):e98, 2011.
[full text]
Primary Motif |
Next Top |
| Name | Preview | Significant Secondaries | List |
|---|---|---|---|
| UP00098 2 (Rfx3 secondary) |
ACTGACGCTTGGTTACCACAAAG
|
35 | UP00129 1 (Pou3f1 3819.1), AAACATTW (DREME), UP00077 2 (Srf secondary), UP00094 2 (Zfp128 secondary), ACACRB (DREME), MA0485.1 (Hoxc9), GCTGGRGA (DREME), UP00255 1 (Dbx1 3486.1), UP00027 1 (Osr1 primary), UP00021 1 (Zfp281 primary), UP00188 1 (Lmx1a 2238.2), MA0009.1 (T), RAGKTCA (DREME), UP00022 1 (Zfp740 primary), UP00407 2 (Elf3 secondary), UP00067 2 (Lef1 secondary), UP00014 1 (Sox17 primary), UP00105 1 (Pou3f4 3773.1), UP00034 1 (Sox7 primary), UP00073 2 (Foxa2 secondary) |
Sequence Database |
Previous Next Top |
| Name | Last Modified | Loaded | Too Short | No Primary | Too Similar | Used |
|---|---|---|---|---|---|---|
| Static Sex-independent | Wed Jun 7 10:47:08 2017 | 67058 | 0 | 51107 | 1 | 15950 |
Secondary Databases |
Previous Next Top |
| Name | Last Modified | Number of Motifs | Motifs Significant | Motifs Redundant |
|---|---|---|---|---|
| meme.xml | Wed Jun 7 10:49:30 2017 | 3 | 0 | 0 |
| dreme.xml | Wed Jun 7 15:52:22 2017 | 63 | 4 | 0 |
| JASPAR CORE 2014 vertebrates | Wed Jun 7 10:46:42 2017 | 205 | 7 | 2 |
| uniprobe mouse | Wed Jun 7 10:46:42 2017 | 385 | 24 | 5 |
Spacings of "UP00129 1 (Pou3f1 3819.1)" relative to "UP00098 2 (Rfx3 secondary)" |
Previous Next Top |
| Primary: UP00098 2 (Rfx3 secondary) | Secondary: UP00129 1 (Pou3f1 3819.1) | E-value |
|---|---|---|
|
ACTGACGCTTGGTTACCACAAAG
|
AATTAATTAATTAATTC
|
0.0015 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2316Motif Databaseuniprobe mouse |
|||||||||||
| Similar Secondary: UP00237 1 (Otp 3496.1) | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1055Alignment by most significant spacings
|
|||||||||||||||||||
| Similar Secondary: UP00142 1 (Uncx4.1 2281.2) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1394Alignment by most significant spacings
|
|||||||||||||||
Spacings of "AAACATTW (DREME)" relative to "UP00098 2 (Rfx3 secondary)" |
Previous Next Top |
| Primary: UP00098 2 (Rfx3 secondary) | Secondary: AAACATTW (DREME) | E-value |
|---|---|---|
|
ACTGACGCTTGGTTACCACAAAG
|
AAACATTT
|
0.0016 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif530Motif Databasedreme.xml |
|||||||||||
| Similar Secondary: MA0046.1 (HNF1A) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2531Alignment by most significant spacings
|
|||||||||||||||
Spacings of "UP00077 2 (Srf secondary)" relative to "UP00098 2 (Rfx3 secondary)" |
Previous Next Top |
| Primary: UP00098 2 (Rfx3 secondary) | Secondary: UP00077 2 (Srf secondary) | E-value |
|---|---|---|
|
ACTGACGCTTGGTTACCACAAAG
|
GTTAAAAAAAAAAATTT
|
0.0017 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7719Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "UP00094 2 (Zfp128 secondary)" relative to "UP00098 2 (Rfx3 secondary)" |
Previous Next Top |
| Primary: UP00098 2 (Rfx3 secondary) | Secondary: UP00094 2 (Zfp128 secondary) | E-value |
|---|---|---|
|
ACTGACGCTTGGTTACCACAAAG
|
TGTATATATATACC
|
0.0034 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3978Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "ACACRB (DREME)" relative to "UP00098 2 (Rfx3 secondary)" |
Previous Next Top |
| Primary: UP00098 2 (Rfx3 secondary) | Secondary: ACACRB (DREME) | E-value |
|---|---|---|
|
ACTGACGCTTGGTTACCACAAAG
|
ACACAG
|
0.0071 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif9658Motif Databasedreme.xml |
|||||||||||
Spacings of "MA0485.1 (Hoxc9)" relative to "UP00098 2 (Rfx3 secondary)" |
Previous Next Top |
| Primary: UP00098 2 (Rfx3 secondary) | Secondary: MA0485.1 (Hoxc9) | E-value |
|---|---|---|
|
ACTGACGCTTGGTTACCACAAAG
|
GGCCATAAATCAC
|
0.028 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2799Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "GCTGGRGA (DREME)" relative to "UP00098 2 (Rfx3 secondary)" |
Previous Next Top |
| Primary: UP00098 2 (Rfx3 secondary) | Secondary: GCTGGRGA (DREME) | E-value |
|---|---|---|
|
ACTGACGCTTGGTTACCACAAAG
|
GCTGGAGA
|
0.03 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1057Motif Databasedreme.xml |
|||||||||||
Spacings of "UP00255 1 (Dbx1 3486.1)" relative to "UP00098 2 (Rfx3 secondary)" |
Previous Next Top |
| Primary: UP00098 2 (Rfx3 secondary) | Secondary: UP00255 1 (Dbx1 3486.1) | E-value |
|---|---|---|
|
ACTGACGCTTGGTTACCACAAAG
|
TAATTAATTAATAATTA
|
0.057 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6056Motif Databaseuniprobe mouse |
|||||||||||||||||||
| Similar Secondary: UP00136 1 (Prrx2 3072.1) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1432Alignment by most significant spacings
|
|||||||||||||||
Spacings of "UP00027 1 (Osr1 primary)" relative to "UP00098 2 (Rfx3 secondary)" |
Previous Next Top |
| Primary: UP00098 2 (Rfx3 secondary) | Secondary: UP00027 1 (Osr1 primary) | E-value |
|---|---|---|
|
ACTGACGCTTGGTTACCACAAAG
|
TTTTACAGTAGCAAAA
|
0.089 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3337Motif Databaseuniprobe mouse |
|||||||||||
| Similar Secondary: UP00052 1 (Osr2 primary) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3248Alignment by most significant spacings
|
|||||||||||||||
Spacings of "UP00021 1 (Zfp281 primary)" relative to "UP00098 2 (Rfx3 secondary)" |
Previous Next Top |
| Primary: UP00098 2 (Rfx3 secondary) | Secondary: UP00021 1 (Zfp281 primary) | E-value |
|---|---|---|
|
ACTGACGCTTGGTTACCACAAAG
|
TCCCCCCCCCCCCCC
|
0.14 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5959Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00188 1 (Lmx1a 2238.2)" relative to "UP00098 2 (Rfx3 secondary)" |
Previous Next Top |
| Primary: UP00098 2 (Rfx3 secondary) | Secondary: UP00188 1 (Lmx1a 2238.2) | E-value |
|---|---|---|
|
ACTGACGCTTGGTTACCACAAAG
|
CGAATTAATTAAAAACC
|
0.17 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2790Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0009.1 (T)" relative to "UP00098 2 (Rfx3 secondary)" |
Previous Next Top |
| Primary: UP00098 2 (Rfx3 secondary) | Secondary: MA0009.1 (T) | E-value |
|---|---|---|
|
ACTGACGCTTGGTTACCACAAAG
|
CTAGGTGTGAA
|
0.21 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif519Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||||||
| Similar Secondary: UP00192 1 (Six1 0935.2) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2302Alignment by most significant spacings
|
|||||||||||||||
| Similar Secondary: MA0116.1 (Zfp423) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif612Alignment by most significant spacings
|
|||||||||||||||
Spacings of "RAGKTCA (DREME)" relative to "UP00098 2 (Rfx3 secondary)" |
Previous Next Top |
| Primary: UP00098 2 (Rfx3 secondary) | Secondary: RAGKTCA (DREME) | E-value |
|---|---|---|
|
ACTGACGCTTGGTTACCACAAAG
|
AAGGTCA
|
0.22 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4441Motif Databasedreme.xml |
|||||||||||
Spacings of "UP00022 1 (Zfp740 primary)" relative to "UP00098 2 (Rfx3 secondary)" |
Previous Next Top |
| Primary: UP00098 2 (Rfx3 secondary) | Secondary: UP00022 1 (Zfp740 primary) | E-value |
|---|---|---|
|
ACTGACGCTTGGTTACCACAAAG
|
CCCCCCCCCCCACTTG
|
0.27 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5676Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00407 2 (Elf3 secondary)" relative to "UP00098 2 (Rfx3 secondary)" |
Previous Next Top |
| Primary: UP00098 2 (Rfx3 secondary) | Secondary: UP00407 2 (Elf3 secondary) | E-value |
|---|---|---|
|
ACTGACGCTTGGTTACCACAAAG
|
GTTCAAAAAAAAAATTC
|
0.33 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7413Motif Databaseuniprobe mouse |
|||||||||||||||||||||||||||||||
Spacings of "UP00067 2 (Lef1 secondary)" relative to "UP00098 2 (Rfx3 secondary)" |
Previous Next Top |
| Primary: UP00098 2 (Rfx3 secondary) | Secondary: UP00067 2 (Lef1 secondary) | E-value |
|---|---|---|
|
ACTGACGCTTGGTTACCACAAAG
|
GAAGATCAATCACTTA
|
0.7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4707Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00014 1 (Sox17 primary)" relative to "UP00098 2 (Rfx3 secondary)" |
Previous Next Top |
| Primary: UP00098 2 (Rfx3 secondary) | Secondary: UP00014 1 (Sox17 primary) | E-value |
|---|---|---|
|
ACTGACGCTTGGTTACCACAAAG
|
ATAAACAATTAATCA
|
0.92 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5640Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00105 1 (Pou3f4 3773.1)" relative to "UP00098 2 (Rfx3 secondary)" |
Previous Next Top |
| Primary: UP00098 2 (Rfx3 secondary) | Secondary: UP00105 1 (Pou3f4 3773.1) | E-value |
|---|---|---|
|
ACTGACGCTTGGTTACCACAAAG
|
AATTAATTAATTAATTC
|
1.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2533Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "UP00034 1 (Sox7 primary)" relative to "UP00098 2 (Rfx3 secondary)" |
Previous Next Top |
| Primary: UP00098 2 (Rfx3 secondary) | Secondary: UP00034 1 (Sox7 primary) | E-value |
|---|---|---|
|
ACTGACGCTTGGTTACCACAAAG
|
AATAAAGAACAATAGAATTTCA
|
2.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5419Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00073 2 (Foxa2 secondary)" relative to "UP00098 2 (Rfx3 secondary)" |
Previous Next Top |
| Primary: UP00098 2 (Rfx3 secondary) | Secondary: UP00073 2 (Foxa2 secondary) | E-value |
|---|---|---|
|
ACTGACGCTTGGTTACCACAAAG
|
AAAAATAACAAACGG
|
2.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7718Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0594.1 (Hoxa9)" relative to "UP00098 2 (Rfx3 secondary)" |
Previous Next Top |
| Primary: UP00098 2 (Rfx3 secondary) | Secondary: MA0594.1 (Hoxa9) | E-value |
|---|---|---|
|
ACTGACGCTTGGTTACCACAAAG
|
GCCATAAATCA
|
2.6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2584Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00228 1 (Bapx1 2343.1)" relative to "UP00098 2 (Rfx3 secondary)" |
Previous Next Top |
| Primary: UP00098 2 (Rfx3 secondary) | Secondary: UP00228 1 (Bapx1 2343.1) | E-value |
|---|---|---|
|
ACTGACGCTTGGTTACCACAAAG
|
CATAACCACTTAACAAC
|
2.9 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3715Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0498.1 (Meis1)" relative to "UP00098 2 (Rfx3 secondary)" |
Previous Next Top |
| Primary: UP00098 2 (Rfx3 secondary) | Secondary: MA0498.1 (Meis1) | E-value |
|---|---|---|
|
ACTGACGCTTGGTTACCACAAAG
|
AGCTGTCACTCACCT
|
3 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6353Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0041.1 (Foxd3)" relative to "UP00098 2 (Rfx3 secondary)" |
Previous Next Top |
| Primary: UP00098 2 (Rfx3 secondary) | Secondary: MA0041.1 (Foxd3) | E-value |
|---|---|---|
|
ACTGACGCTTGGTTACCACAAAG
|
GAATGTTTGTTT
|
3.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5357Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00083 2 (Tcf7l2 secondary)" relative to "UP00098 2 (Rfx3 secondary)" |
Previous Next Top |
| Primary: UP00098 2 (Rfx3 secondary) | Secondary: UP00083 2 (Tcf7l2 secondary) | E-value |
|---|---|---|
|
ACTGACGCTTGGTTACCACAAAG
|
GAAGATCAATCACTAA
|
3.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4843Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0033.1 (FOXL1)" relative to "UP00098 2 (Rfx3 secondary)" |
Previous Next Top |
| Primary: UP00098 2 (Rfx3 secondary) | Secondary: MA0033.1 (FOXL1) | E-value |
|---|---|---|
|
ACTGACGCTTGGTTACCACAAAG
|
TATACATA
|
4.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6654Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0122.1 (Nkx3-2)" relative to "UP00098 2 (Rfx3 secondary)" |
Previous Next Top |
| Primary: UP00098 2 (Rfx3 secondary) | Secondary: MA0122.1 (Nkx3-2) | E-value |
|---|---|---|
|
ACTGACGCTTGGTTACCACAAAG
|
TTAAGTGGA
|
5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif11202Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00024 2 (Glis2 secondary)" relative to "UP00098 2 (Rfx3 secondary)" |
Previous Next Top |
| Primary: UP00098 2 (Rfx3 secondary) | Secondary: UP00024 2 (Glis2 secondary) | E-value |
|---|---|---|
|
ACTGACGCTTGGTTACCACAAAG
|
AATATTAATAAAGA
|
5.6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5936Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "UP00016 1 (Sry primary)" relative to "UP00098 2 (Rfx3 secondary)" |
Previous Next Top |
| Primary: UP00098 2 (Rfx3 secondary) | Secondary: UP00016 1 (Sry primary) | E-value |
|---|---|---|
|
ACTGACGCTTGGTTACCACAAAG
|
TATAATTATAATATTC
|
5.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1466Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00224 1 (Pax6 3838.3)" relative to "UP00098 2 (Rfx3 secondary)" |
Previous Next Top |
| Primary: UP00098 2 (Rfx3 secondary) | Secondary: UP00224 1 (Pax6 3838.3) | E-value |
|---|---|---|
|
ACTGACGCTTGGTTACCACAAAG
|
TGATTAATTAATTGAC
|
6.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3335Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00097 2 (Mtf1 secondary)" relative to "UP00098 2 (Rfx3 secondary)" |
Previous Next Top |
| Primary: UP00098 2 (Rfx3 secondary) | Secondary: UP00097 2 (Mtf1 secondary) | E-value |
|---|---|---|
|
ACTGACGCTTGGTTACCACAAAG
|
AAATAAGAAAAAAC
|
7 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6054Motif Databaseuniprobe mouse |
|||||||||||||||
Spacings of "UP00020 1 (Atf1 primary)" relative to "UP00098 2 (Rfx3 secondary)" |
Previous Next Top |
| Primary: UP00098 2 (Rfx3 secondary) | Secondary: UP00020 1 (Atf1 primary) | E-value |
|---|---|---|
|
ACTGACGCTTGGTTACCACAAAG
|
ACGATGACGTCATCGA
|
7.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1462Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00062 1 (Sox4 primary)" relative to "UP00098 2 (Rfx3 secondary)" |
Previous Next Top |
| Primary: UP00098 2 (Rfx3 secondary) | Secondary: UP00062 1 (Sox4 primary) | E-value |
|---|---|---|
|
ACTGACGCTTGGTTACCACAAAG
|
AGAAGAACAAAGGACTA
|
7.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6115Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00075 1 (Sox15 primary)" relative to "UP00098 2 (Rfx3 secondary)" |
Previous Next Top |
| Primary: UP00098 2 (Rfx3 secondary) | Secondary: UP00075 1 (Sox15 primary) | E-value |
|---|---|---|
|
ACTGACGCTTGGTTACCACAAAG
|
TAGTGAACAATAGATTT
|
7.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6115Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00051 2 (Sox8 secondary)" relative to "UP00098 2 (Rfx3 secondary)" |
Previous Next Top |
| Primary: UP00098 2 (Rfx3 secondary) | Secondary: UP00051 2 (Sox8 secondary) | E-value |
|---|---|---|
|
ACTGACGCTTGGTTACCACAAAG
|
ACATTCATGACACG
|
9.9 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6844Motif Databaseuniprobe mouse |
|||||||||||