The name of the primary motif.
The logo of the primary motif.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The number of secondary motifs found that had significant spacings in the tested region.
The list of secondary motifs found that had significant spacings in the tested region.
The name of the sequence database.
The last modified date of the sequence database.
The number of sequences in the sequence database.
The number of sequences in the sequence database which were excluded because they were shorter than twice the margin plus the primary motif length.
The number of sequences in the sequence database which were excluded because no match to the primary motif could be found at a distance to the edges larger than the margin.
The number of sequences in the sequence database which were excluded because they were largly identical to other sequences when aligned on the primary motif site.
The number of sequences which were scanned with the secondary motifs.
The name of the motif database derived from the file name.
The date that the motif database was last modified.
The number of motifs loaded from the motif database. Some motifs may have been excluded.
The number of motifs with significant E-values whose significant spacings were not considered too similar to those of another motif.
The number of motifs that while having significant spacings were less signficant than another motif that matched most of the same sites.
The primary motif is used as the reference point for all spacing calculation.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The secondary motif occurs at the spacings relative to the primary shown in the histogram below.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
The E-value is the lowest p-value of any spacing of the secondary motif times the number of secondary motifs. It estimates the expected number of random secondary motifs that would have the observed minimum p-value or less.
The histogram below shows the frequency of spacings from the primary motif to the secondary motif. Red bars indicate that a spacing has occured a statistically significant number of times.
The details of the significant spacings are shown in the four quadrants as they relate to the quadrants of the graph.
The total number of sequences that have a match for both the primary motif and this secondary motif.
The motif database which this secondary motif came from.
The list of secondary motifs which have been identified as possibly similar to this motif because their most significant spacings overlaped with the most significant spacing of this motif. Check the boxes to show the possibly similar secondary motifs.
This shows the first secondary motif aligned with the current secondary motif by the most significant spacing.
Sections of the motif with a gray background have been trimmed and were not used for scanning.
For further information on how to interpret these results or to get a copy of the MEME software please access http://meme.nbcr.net.
If you use SpaMo in your research please cite the following paper:
Tom Whitington, Martin C. Frith, James Johnson and Timothy L. Bailey,
"Inferring transcription factor complexes from ChIP-seq data",
Nucleic Acids Research, 39(15):e98, 2011.
[full text]
Primary Motif |
Next Top |
| Name | Preview | Significant Secondaries | List |
|---|---|---|---|
| MA0503.1 (Nkx2-5) |
AGCCACTCAAG
|
36 | AGGCDGAG (DREME), CCBGCCTC (DREME), CTGTAAYY (DREME), MA0151.1 (ARID3A), MA0502.1 (NFYB), UP00077 2 (Srf secondary), MA0060.2 (NFYA), UP00054 1 (Tcf7 primary), AGGHCA (DREME), UP00407 2 (Elf3 secondary), MA0139.1 (CTCF), MA0512.1 (Rxra), MA0528.1 (ZNF263), UP00029 1 (Tbp primary), CYCCDCCC (DREME), UP00034 1 (Sox7 primary), UP00153 1 (Pitx1 2312.1), UP00071 1 (Sox21 primary), UP00178 1 (Og2x 3719.1), UP00094 2 (Zfp128 secondary) |
Sequence Database |
Previous Next Top |
| Name | Last Modified | Loaded | Too Short | No Primary | Too Similar | Used |
|---|---|---|---|---|---|---|
| Static Sex-independent | Wed Jun 7 10:47:08 2017 | 67058 | 0 | 50615 | 2 | 16441 |
Secondary Databases |
Previous Next Top |
| Name | Last Modified | Number of Motifs | Motifs Significant | Motifs Redundant |
|---|---|---|---|---|
| meme.xml | Wed Jun 7 10:49:30 2017 | 3 | 1 | 0 |
| dreme.xml | Wed Jun 7 15:52:22 2017 | 63 | 6 | 2 |
| JASPAR CORE 2014 vertebrates | Wed Jun 7 10:46:42 2017 | 204 | 12 | 2 |
| uniprobe mouse | Wed Jun 7 10:46:42 2017 | 386 | 17 | 3 |
Spacings of "AGGCDGAG (DREME)" relative to "MA0503.1 (Nkx2-5)" |
Previous Next Top |
| Primary: MA0503.1 (Nkx2-5) | Secondary: AGGCDGAG (DREME) | E-value |
|---|---|---|
|
AGCCACTCAAG
|
AGGCTGAG
|
8.1e-30 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1740Motif Databasedreme.xml |
|||||||||||
Spacings of "CCBGCCTC (DREME)" relative to "MA0503.1 (Nkx2-5)" |
Previous Next Top |
| Primary: MA0503.1 (Nkx2-5) | Secondary: CCBGCCTC (DREME) | E-value |
|---|---|---|
|
AGCCACTCAAG
|
CCTGCCTC
|
6.2e-13 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1518Motif Databasedreme.xml |
|||||||||||||||||||
Spacings of "CTGTAAYY (DREME)" relative to "MA0503.1 (Nkx2-5)" |
Previous Next Top |
| Primary: MA0503.1 (Nkx2-5) | Secondary: CTGTAAYY (DREME) | E-value |
|---|---|---|
|
AGCCACTCAAG
|
CTGTAACT
|
4.9e-08 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif780Motif Databasedreme.xml |
|||||||||||
Spacings of "MA0151.1 (ARID3A)" relative to "MA0503.1 (Nkx2-5)" |
Previous Next Top |
| Primary: MA0503.1 (Nkx2-5) | Secondary: MA0151.1 (ARID3A) | E-value |
|---|---|---|
|
AGCCACTCAAG
|
ATTAAA
|
1e-05 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6275Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
| Similar Secondary: TTTAWW (DREME) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5868Alignment by most significant spacings
|
|||||||||||||||
Spacings of "MA0502.1 (NFYB)" relative to "MA0503.1 (Nkx2-5)" |
Previous Next Top |
| Primary: MA0503.1 (Nkx2-5) | Secondary: MA0502.1 (NFYB) | E-value |
|---|---|---|
|
AGCCACTCAAG
|
AAATGGACCAATCAG
|
0.0058 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2094Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00077 2 (Srf secondary)" relative to "MA0503.1 (Nkx2-5)" |
Previous Next Top |
| Primary: MA0503.1 (Nkx2-5) | Secondary: UP00077 2 (Srf secondary) | E-value |
|---|---|---|
|
AGCCACTCAAG
|
GTTAAAAAAAAAAATTT
|
0.0088 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7556Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "MA0060.2 (NFYA)" relative to "MA0503.1 (Nkx2-5)" |
Previous Next Top |
| Primary: MA0503.1 (Nkx2-5) | Secondary: MA0060.2 (NFYA) | E-value |
|---|---|---|
|
AGCCACTCAAG
|
AGAGTGCTGATTGGTCCA
|
0.02 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1510Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00054 1 (Tcf7 primary)" relative to "MA0503.1 (Nkx2-5)" |
Previous Next Top |
| Primary: MA0503.1 (Nkx2-5) | Secondary: UP00054 1 (Tcf7 primary) | E-value |
|---|---|---|
|
AGCCACTCAAG
|
TATAGATCAAAGGAAAA
|
0.021 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7066Motif Databaseuniprobe mouse |
|||||||||||
| Similar Secondary: UP00067 1 (Lef1 primary) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4056Alignment by most significant spacings
|
|||||||||||||||
| Similar Secondary: UP00058 1 (Tcf3 primary) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6647Alignment by most significant spacings
|
|||||||||||||||
| Similar Secondary: UP00083 1 (Tcf7l2 primary) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5087Alignment by most significant spacings
|
|||||||||||||||
Spacings of "AGGHCA (DREME)" relative to "MA0503.1 (Nkx2-5)" |
Previous Next Top |
| Primary: MA0503.1 (Nkx2-5) | Secondary: AGGHCA (DREME) | E-value |
|---|---|---|
|
AGCCACTCAAG
|
AGGCCA
|
0.11 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif10332Motif Databasedreme.xml |
|||||||||||
| Similar Secondary: MA0160.1 (NR4A2) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif11025Alignment by most significant spacings
|
|||||||||||||||
Spacings of "UP00407 2 (Elf3 secondary)" relative to "MA0503.1 (Nkx2-5)" |
Previous Next Top |
| Primary: MA0503.1 (Nkx2-5) | Secondary: UP00407 2 (Elf3 secondary) | E-value |
|---|---|---|
|
AGCCACTCAAG
|
GTTCAAAAAAAAAATTC
|
0.13 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7114Motif Databaseuniprobe mouse |
|||||||||||||||||||
Spacings of "MA0139.1 (CTCF)" relative to "MA0503.1 (Nkx2-5)" |
Previous Next Top |
| Primary: MA0503.1 (Nkx2-5) | Secondary: MA0139.1 (CTCF) | E-value |
|---|---|---|
|
AGCCACTCAAG
|
TGGCCACCAGGGGGCGCTA
|
0.47 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3731Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0512.1 (Rxra)" relative to "MA0503.1 (Nkx2-5)" |
Previous Next Top |
| Primary: MA0503.1 (Nkx2-5) | Secondary: MA0512.1 (Rxra) | E-value |
|---|---|---|
|
AGCCACTCAAG
|
CAAAGGTCAGA
|
0.5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8579Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||||||
| Similar Secondary: ARAGGGCA (DREME) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1115Alignment by most significant spacings
|
|||||||||||||||
Spacings of "MA0528.1 (ZNF263)" relative to "MA0503.1 (Nkx2-5)" |
Previous Next Top |
| Primary: MA0503.1 (Nkx2-5) | Secondary: MA0528.1 (ZNF263) | E-value |
|---|---|---|
|
AGCCACTCAAG
|
GGAGGAGGAGGGGGAGGAGGA
|
0.6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8275Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||||||
Spacings of "UP00029 1 (Tbp primary)" relative to "MA0503.1 (Nkx2-5)" |
Previous Next Top |
| Primary: MA0503.1 (Nkx2-5) | Secondary: UP00029 1 (Tbp primary) | E-value |
|---|---|---|
|
AGCCACTCAAG
|
TCTTTATATATAAATA
|
1.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3840Motif Databaseuniprobe mouse |
|||||||||||||||
Spacings of "CYCCDCCC (DREME)" relative to "MA0503.1 (Nkx2-5)" |
Previous Next Top |
| Primary: MA0503.1 (Nkx2-5) | Secondary: CYCCDCCC (DREME) | E-value |
|---|---|---|
|
AGCCACTCAAG
|
CCCCTCCC
|
1.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif4235Motif Databasedreme.xml |
|||||||||||
Spacings of "UP00034 1 (Sox7 primary)" relative to "MA0503.1 (Nkx2-5)" |
Previous Next Top |
| Primary: MA0503.1 (Nkx2-5) | Secondary: UP00034 1 (Sox7 primary) | E-value |
|---|---|---|
|
AGCCACTCAAG
|
AATAAAGAACAATAGAATTTCA
|
1.9 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5072Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00153 1 (Pitx1 2312.1)" relative to "MA0503.1 (Nkx2-5)" |
Previous Next Top |
| Primary: MA0503.1 (Nkx2-5) | Secondary: UP00153 1 (Pitx1 2312.1) | E-value |
|---|---|---|
|
AGCCACTCAAG
|
TTAGAGGGATTAACAAT
|
2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2831Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00071 1 (Sox21 primary)" relative to "MA0503.1 (Nkx2-5)" |
Previous Next Top |
| Primary: MA0503.1 (Nkx2-5) | Secondary: UP00071 1 (Sox21 primary) | E-value |
|---|---|---|
|
AGCCACTCAAG
|
TTTAATTATAATTAAG
|
2.9 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3818Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00178 1 (Og2x 3719.1)" relative to "MA0503.1 (Nkx2-5)" |
Previous Next Top |
| Primary: MA0503.1 (Nkx2-5) | Secondary: UP00178 1 (Og2x 3719.1) | E-value |
|---|---|---|
|
AGCCACTCAAG
|
CGCGCTAATTAGGTATC
|
2.9 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2890Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00094 2 (Zfp128 secondary)" relative to "MA0503.1 (Nkx2-5)" |
Previous Next Top |
| Primary: MA0503.1 (Nkx2-5) | Secondary: UP00094 2 (Zfp128 secondary) | E-value |
|---|---|---|
|
AGCCACTCAAG
|
TGTATATATATACC
|
3.5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3814Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0466.1 (CEBPB)" relative to "MA0503.1 (Nkx2-5)" |
Previous Next Top |
| Primary: MA0503.1 (Nkx2-5) | Secondary: MA0466.1 (CEBPB) | E-value |
|---|---|---|
|
AGCCACTCAAG
|
TATTGCACAAT
|
3.5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3239Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||||||||||
| Similar Secondary: MA0102.3 (CEBPA) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif3972Alignment by most significant spacings
|
|||||||||||||||
Spacings of "UP00082 2 (Zfp187 secondary)" relative to "MA0503.1 (Nkx2-5)" |
Previous Next Top |
| Primary: MA0503.1 (Nkx2-5) | Secondary: UP00082 2 (Zfp187 secondary) | E-value |
|---|---|---|
|
AGCCACTCAAG
|
GAGCCCTTGTCCCTTG
|
4.4 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif7846Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0505.1 (Nr5a2)" relative to "MA0503.1 (Nkx2-5)" |
Previous Next Top |
| Primary: MA0503.1 (Nkx2-5) | Secondary: MA0505.1 (Nr5a2) | E-value |
|---|---|---|
|
AGCCACTCAAG
|
AAGTTCAAGGTCAGC
|
4.5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5119Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0478.1 (FOSL2)" relative to "MA0503.1 (Nkx2-5)" |
Previous Next Top |
| Primary: MA0503.1 (Nkx2-5) | Secondary: MA0478.1 (FOSL2) | E-value |
|---|---|---|
|
AGCCACTCAAG
|
GGATGACTCAT
|
5.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2465Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00057 2 (Zic2 secondary)" relative to "MA0503.1 (Nkx2-5)" |
Previous Next Top |
| Primary: MA0503.1 (Nkx2-5) | Secondary: UP00057 2 (Zic2 secondary) | E-value |
|---|---|---|
|
AGCCACTCAAG
|
CCACACAGCAGGAGA
|
5.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8015Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00021 1 (Zfp281 primary)" relative to "MA0503.1 (Nkx2-5)" |
Previous Next Top |
| Primary: MA0503.1 (Nkx2-5) | Secondary: UP00021 1 (Zfp281 primary) | E-value |
|---|---|---|
|
AGCCACTCAAG
|
TCCCCCCCCCCCCCC
|
5.8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif6507Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00184 1 (Lhx8 2247.2)" relative to "MA0503.1 (Nkx2-5)" |
Previous Next Top |
| Primary: MA0503.1 (Nkx2-5) | Secondary: UP00184 1 (Lhx8 2247.2) | E-value |
|---|---|---|
|
AGCCACTCAAG
|
ACCCCTAATTAGCGGTG
|
5.9 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2188Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00227 1 (Duxl 1286.2)" relative to "MA0503.1 (Nkx2-5)" |
Previous Next Top |
| Primary: MA0503.1 (Nkx2-5) | Secondary: UP00227 1 (Duxl 1286.2) | E-value |
|---|---|---|
|
AGCCACTCAAG
|
CGACCCAATCAACGGTG
|
6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1916Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "3 (MEME)" relative to "MA0503.1 (Nkx2-5)" |
Previous Next Top |
| Primary: MA0503.1 (Nkx2-5) | Secondary: 3 (MEME) | E-value |
|---|---|---|
|
AGCCACTCAAG
|
TTTGTTTTTTTTTTTGTTTGTTTTTAAG
|
6 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif885Motif Databasememe.xml |
|||||||||||
Spacings of "MA0507.1 (POU2F2)" relative to "MA0503.1 (Nkx2-5)" |
Previous Next Top |
| Primary: MA0503.1 (Nkx2-5) | Secondary: MA0507.1 (POU2F2) | E-value |
|---|---|---|
|
AGCCACTCAAG
|
TTCATTTGCATAT
|
6.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1456Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "MA0104.3 (Mycn)" relative to "MA0503.1 (Nkx2-5)" |
Previous Next Top |
| Primary: MA0503.1 (Nkx2-5) | Secondary: MA0104.3 (Mycn) | E-value |
|---|---|---|
|
AGCCACTCAAG
|
GCCACGTG
|
7.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif2584Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||
Spacings of "UP00159 1 (Six2 2307.2)" relative to "MA0503.1 (Nkx2-5)" |
Previous Next Top |
| Primary: MA0503.1 (Nkx2-5) | Secondary: UP00159 1 (Six2 2307.2) | E-value |
|---|---|---|
|
AGCCACTCAAG
|
AATGGGGTATCACTTTT
|
7.5 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif1430Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "CGGKGAC (DREME)" relative to "MA0503.1 (Nkx2-5)" |
Previous Next Top |
| Primary: MA0503.1 (Nkx2-5) | Secondary: CGGKGAC (DREME) | E-value |
|---|---|---|
|
AGCCACTCAAG
|
CGGGGAC
|
8 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif838Motif Databasedreme.xml |
|||||||||||
Spacings of "UP00035 1 (Hic1 primary)" relative to "MA0503.1 (Nkx2-5)" |
Previous Next Top |
| Primary: MA0503.1 (Nkx2-5) | Secondary: UP00035 1 (Hic1 primary) | E-value |
|---|---|---|
|
AGCCACTCAAG
|
ACTATGCCAACCTACC
|
8.1 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5083Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "UP00095 2 (Zfp691 secondary)" relative to "MA0503.1 (Nkx2-5)" |
Previous Next Top |
| Primary: MA0503.1 (Nkx2-5) | Secondary: UP00095 2 (Zfp691 secondary) | E-value |
|---|---|---|
|
AGCCACTCAAG
|
TACGAGACTCCTCTAAC
|
8.2 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif8006Motif Databaseuniprobe mouse |
|||||||||||
Spacings of "MA0592.1 (ESRRA)" relative to "MA0503.1 (Nkx2-5)" |
Previous Next Top |
| Primary: MA0503.1 (Nkx2-5) | Secondary: MA0592.1 (ESRRA) | E-value |
|---|---|---|
|
AGCCACTCAAG
|
CCAAGGTCACA
|
9.9 |
| Motif Spacing Histogram | Significant Motif Spacings (p<0.05) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Upstream | Downstream | Upstream | Downstream | Other Details | |||||||||
Same Strand
Opposite Strand
|
|
Total sequences with primary and secondary motif5114Motif DatabaseJASPAR CORE 2014 vertebrates |
|||||||||||